Incidental Mutation 'R2417:Ncbp1'
ID249028
Institutional Source Beutler Lab
Gene Symbol Ncbp1
Ensembl Gene ENSMUSG00000028330
Gene Namenuclear cap binding protein subunit 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location46138613-46172403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46168530 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 626 (S626L)
Ref Sequence ENSEMBL: ENSMUSP00000030014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030014] [ENSMUST00000058232]
PDB Structure
Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030014
AA Change: S626L

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: S626L

DomainStartEndE-ValueType
MIF4G 28 240 1.33e-38 SMART
Pfam:MIF4G_like 309 471 1.4e-37 PFAM
Pfam:MIF4G_like_2 485 754 4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058232
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133286
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Ncbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ncbp1 APN 4 46161307 missense probably damaging 1.00
IGL02085:Ncbp1 APN 4 46159699 missense probably damaging 0.96
IGL02230:Ncbp1 APN 4 46165272 missense probably benign 0.03
IGL02561:Ncbp1 APN 4 46159711 missense possibly damaging 0.80
IGL02574:Ncbp1 APN 4 46168449 critical splice acceptor site probably null
IGL03371:Ncbp1 APN 4 46171991 nonsense probably null
R0549:Ncbp1 UTSW 4 46168476 missense possibly damaging 0.69
R0594:Ncbp1 UTSW 4 46170551 missense probably benign 0.00
R0699:Ncbp1 UTSW 4 46147528 missense probably benign 0.17
R0725:Ncbp1 UTSW 4 46152056 missense probably benign 0.01
R0961:Ncbp1 UTSW 4 46165193 missense possibly damaging 0.69
R1330:Ncbp1 UTSW 4 46167354 missense probably benign 0.19
R1622:Ncbp1 UTSW 4 46171963 missense possibly damaging 0.60
R1756:Ncbp1 UTSW 4 46169131 nonsense probably null
R4050:Ncbp1 UTSW 4 46147483 missense probably damaging 0.99
R4132:Ncbp1 UTSW 4 46169241 nonsense probably null
R4516:Ncbp1 UTSW 4 46157824 missense probably damaging 1.00
R4795:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4796:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4960:Ncbp1 UTSW 4 46165273 nonsense probably null
R5557:Ncbp1 UTSW 4 46165259 missense probably benign 0.01
R5626:Ncbp1 UTSW 4 46161290 missense probably damaging 1.00
R5682:Ncbp1 UTSW 4 46170474 unclassified probably benign
R5859:Ncbp1 UTSW 4 46163026 missense probably benign 0.00
R6377:Ncbp1 UTSW 4 46150703 missense probably damaging 1.00
R6440:Ncbp1 UTSW 4 46147516 missense probably damaging 1.00
R6793:Ncbp1 UTSW 4 46157827 missense probably damaging 0.99
R7078:Ncbp1 UTSW 4 46155756 missense probably benign 0.00
R7434:Ncbp1 UTSW 4 46149910 missense probably damaging 1.00
R7445:Ncbp1 UTSW 4 46149914 missense probably damaging 0.98
R7477:Ncbp1 UTSW 4 46157897 missense probably damaging 1.00
R7670:Ncbp1 UTSW 4 46170015 missense probably damaging 0.96
X0013:Ncbp1 UTSW 4 46150702 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTATGGCTTAAACTGGTCAATTC -3'
(R):5'- AGGCCTCGGTATATTTCTGACAAG -3'

Sequencing Primer
(F):5'- GGCTTAAACTGGTCAATTCTCTTG -3'
(R):5'- CTGACAAGTGTGCTCTGCAAATAGTG -3'
Posted On2014-11-12