Incidental Mutation 'R2417:Fam43b'
ID249029
Institutional Source Beutler Lab
Gene Symbol Fam43b
Ensembl Gene ENSMUSG00000078235
Gene Namefamily with sequence similarity 43, member B
SynonymsOTTMUSG00000009974
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R2417 (G1)
Quality Score96
Status Not validated
Chromosome4
Chromosomal Location138394092-138396528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 138395098 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 304 (R304G)
Ref Sequence ENSEMBL: ENSMUSP00000100649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105032]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062902
Predicted Effect probably benign
Transcript: ENSMUST00000105032
AA Change: R304G

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100649
Gene: ENSMUSG00000078235
AA Change: R304G

DomainStartEndE-ValueType
Pfam:PID_2 71 265 3.4e-75 PFAM
low complexity region 306 315 N/A INTRINSIC
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Fam43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2128:Fam43b UTSW 4 138395988 missense possibly damaging 0.87
R2258:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2281:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2413:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2416:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3705:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3715:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3797:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3798:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3854:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3856:Fam43b UTSW 4 138395098 missense probably benign 0.25
R4639:Fam43b UTSW 4 138395967 missense possibly damaging 0.66
R4868:Fam43b UTSW 4 138395797 missense probably benign 0.32
R5129:Fam43b UTSW 4 138395472 nonsense probably null
R6176:Fam43b UTSW 4 138395211 missense probably damaging 0.99
R7296:Fam43b UTSW 4 138395841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCGACCATTACAGTGAC -3'
(R):5'- AGTCTTCACCTGGGTCTACC -3'

Sequencing Primer
(F):5'- GACCATTACAGTGACCGCGAG -3'
(R):5'- TTCAGCGACTTCAAGCGG -3'
Posted On2014-11-12