Incidental Mutation 'R2417:Vmn2r14'
ID249031
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Namevomeronasal 2, receptor 14
SynonymsEG231591
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109215502-109224622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109224463 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 54 (E54K)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: E54K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: E54K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109216314 nonsense probably null
IGL01504:Vmn2r14 APN 5 109221419 missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109224577 missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109220409 missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109224483 missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109220067 missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109220588 nonsense probably null
IGL02676:Vmn2r14 APN 5 109220016 missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109221439 missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109220188 missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109221426 missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109216394 missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109216107 missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109220484 missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109219836 missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109219044 missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109218896 missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109216360 missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109224574 missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109216251 missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109221417 missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109219972 missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109219047 nonsense probably null
R2013:Vmn2r14 UTSW 5 109221243 missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109218832 splice site probably null
R3029:Vmn2r14 UTSW 5 109215910 missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109224565 missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109216229 missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109220167 missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109221504 missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109216110 missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109221518 splice site probably null
R4896:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109216095 missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109217576 missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109221288 missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109220395 missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109219950 missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109217620 missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109215858 missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109221356 missense probably benign
R5985:Vmn2r14 UTSW 5 109220216 missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109221417 missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109221267 missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109216230 missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109216059 missense probably benign 0.22
R6944:Vmn2r14 UTSW 5 109216274 missense probably benign 0.06
R7608:Vmn2r14 UTSW 5 109221410 missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109220220 missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109221353 missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109220554 missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109221476 missense probably damaging 1.00
Z1177:Vmn2r14 UTSW 5 109219875 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CATTGTGAACTGGAGTCCAATG -3'
(R):5'- ACAACGGCCTGATCTTAGATCC -3'

Sequencing Primer
(F):5'- TGAACTGGAGTCCAATGTAGTAAAAC -3'
(R):5'- ACGGCCTGATCTTAGATCCTAGTAG -3'
Posted On2014-11-12