Incidental Mutation 'R2417:Vmn2r26'
ID249032
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Namevomeronasal 2, receptor 26
SynonymsV2r1b
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124024758-124062035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124061350 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 628 (N628S)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: N628S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: N628S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R7914:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATCAAGTGTCCTGAAGATCAGTATC -3'
(R):5'- TTGAGAGTCGGGTCACCATC -3'

Sequencing Primer
(F):5'- TCCAAATAAACAGAGGAATCAGTGTC -3'
(R):5'- GGGTCACCATCCCCATTTTTAAGATG -3'
Posted On2014-11-12