Incidental Mutation 'R2417:Alpk3'
ID249035
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Namealpha-kinase 3
SynonymsMidori
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R2417 (G1)
Quality Score183
Status Not validated
Chromosome7
Chromosomal Location81057600-81105612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81092753 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 773 (P773T)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
Predicted Effect probably benign
Transcript: ENSMUST00000107348
AA Change: P773T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: P773T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151115
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7411:Alpk3 UTSW 7 81092852 missense probably benign 0.11
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACGGACGTTGTGACACAAG -3'
(R):5'- TTCTTGGGGCACTGAGACAG -3'

Sequencing Primer
(F):5'- CCACAGTCAGACAGGAGTTCATG -3'
(R):5'- GACAGGCTGTCCTCTTGC -3'
Posted On2014-11-12