Incidental Mutation 'R2417:Zfp143'
ID249036
Institutional Source Beutler Lab
Gene Symbol Zfp143
Ensembl Gene ENSMUSG00000061079
Gene Namezinc finger protein 143
SynonymsD7Ertd805e, KRAB14, pHZ-1, Staf, Zfp79, Zfp80-rs1
Accession Numbers

NCBI RefSeq: NM_009281.3; MGI:1277969

Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location110061217-110095394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110069596 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 36 (V36M)
Ref Sequence ENSEMBL: ENSMUSP00000148235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084727] [ENSMUST00000169638] [ENSMUST00000209505] [ENSMUST00000211798]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084727
AA Change: V36M

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081778
Gene: ENSMUSG00000061079
AA Change: V36M

DomainStartEndE-ValueType
ZnF_C2H2 236 260 5.5e-3 SMART
ZnF_C2H2 266 290 6.42e-4 SMART
ZnF_C2H2 296 320 4.01e-5 SMART
ZnF_C2H2 326 350 1.38e-3 SMART
ZnF_C2H2 356 380 3.95e-4 SMART
ZnF_C2H2 386 410 2.4e-3 SMART
ZnF_C2H2 416 439 1.79e-2 SMART
low complexity region 443 457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169638
AA Change: V36M

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126015
Gene: ENSMUSG00000061079
AA Change: V36M

DomainStartEndE-ValueType
ZnF_C2H2 209 233 5.5e-3 SMART
ZnF_C2H2 239 263 6.42e-4 SMART
ZnF_C2H2 269 293 4.01e-5 SMART
ZnF_C2H2 299 323 1.38e-3 SMART
ZnF_C2H2 329 353 3.95e-4 SMART
ZnF_C2H2 359 383 2.4e-3 SMART
ZnF_C2H2 389 412 1.79e-2 SMART
low complexity region 416 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect possibly damaging
Transcript: ENSMUST00000209505
AA Change: V36M

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211798
AA Change: V36M

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype Strain: 2678408
PHENOTYPE: Homozygous disruption of this locus results in fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(86) : Targeted(2) Gene trapped(84)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Zfp143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Zfp143 APN 7 110091772 missense probably damaging 0.99
IGL01610:Zfp143 APN 7 110074126 nonsense probably null
IGL01678:Zfp143 APN 7 110080351 splice site probably benign
IGL01734:Zfp143 APN 7 110072209 splice site probably benign
IGL02505:Zfp143 APN 7 110091786 missense possibly damaging 0.54
IGL02577:Zfp143 APN 7 110091907 missense probably damaging 1.00
IGL03084:Zfp143 APN 7 110069611 splice site probably benign
H8786:Zfp143 UTSW 7 110094368 missense probably damaging 1.00
P0015:Zfp143 UTSW 7 110086111 critical splice acceptor site probably null
R0324:Zfp143 UTSW 7 110077147 missense possibly damaging 0.94
R0445:Zfp143 UTSW 7 110061117 unclassified probably benign
R0668:Zfp143 UTSW 7 110061274 unclassified probably benign
R1178:Zfp143 UTSW 7 110075721 splice site probably benign
R1587:Zfp143 UTSW 7 110074068 missense probably benign 0.06
R1992:Zfp143 UTSW 7 110061282 unclassified probably benign
R2110:Zfp143 UTSW 7 110086246 missense probably damaging 1.00
R2364:Zfp143 UTSW 7 110083242 missense probably damaging 0.97
R2899:Zfp143 UTSW 7 110072129 missense probably damaging 1.00
R3923:Zfp143 UTSW 7 110074191 missense probably damaging 1.00
R4117:Zfp143 UTSW 7 110091913 missense probably damaging 0.97
R4804:Zfp143 UTSW 7 110088769 missense probably damaging 1.00
R5048:Zfp143 UTSW 7 110074118 missense probably damaging 0.99
R5097:Zfp143 UTSW 7 110088791 missense probably damaging 1.00
R5239:Zfp143 UTSW 7 110094352 missense probably damaging 1.00
R5541:Zfp143 UTSW 7 110070480 missense probably benign 0.02
R5543:Zfp143 UTSW 7 110083315 nonsense probably null
R5630:Zfp143 UTSW 7 110088773 missense probably damaging 1.00
R5806:Zfp143 UTSW 7 110086235 nonsense probably null
R6334:Zfp143 UTSW 7 110086131 missense probably damaging 1.00
R6736:Zfp143 UTSW 7 110091814 missense probably damaging 1.00
R7201:Zfp143 UTSW 7 110093080 missense possibly damaging 0.74
R7448:Zfp143 UTSW 7 110070498 missense probably benign 0.00
R7635:Zfp143 UTSW 7 110088818 missense probably benign 0.37
R7717:Zfp143 UTSW 7 110086220 missense possibly damaging 0.93
R8191:Zfp143 UTSW 7 110077157 missense probably damaging 1.00
R8268:Zfp143 UTSW 7 110091784 missense probably benign 0.27
R8368:Zfp143 UTSW 7 110083248 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTGGATTCATGTGCACG -3'
(R):5'- GGGTCTGGATATCATTCAGTCAC -3'

Sequencing Primer
(F):5'- GGATTCATGTGCACGATTCC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2014-11-12