Incidental Mutation 'R2417:Ctf2'
ID249037
Institutional Source Beutler Lab
Gene Symbol Ctf2
Ensembl Gene ENSMUSG00000060034
Gene Namecardiotrophin 2
SynonymsLOC244218, neuropoietin, NP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127718106-127732166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127719587 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 80 (V80A)
Ref Sequence ENSEMBL: ENSMUSP00000075459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047393] [ENSMUST00000076091] [ENSMUST00000206038] [ENSMUST00000206506] [ENSMUST00000206997]
Predicted Effect probably benign
Transcript: ENSMUST00000047393
SMART Domains Protein: ENSMUSP00000049161
Gene: ENSMUSG00000042340

DomainStartEndE-ValueType
SCOP:d1cnt1_ 21 197 1e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076091
AA Change: V80A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075459
Gene: ENSMUSG00000060034
AA Change: V80A

DomainStartEndE-ValueType
Pfam:CNTF 22 204 1.6e-15 PFAM
Pfam:PRF 31 204 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205655
Predicted Effect probably benign
Transcript: ENSMUST00000206038
AA Change: V40A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206073
Predicted Effect probably benign
Transcript: ENSMUST00000206506
Predicted Effect probably benign
Transcript: ENSMUST00000206997
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Ctf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1166:Ctf2 UTSW 7 127719513 missense probably benign 0.01
R4574:Ctf2 UTSW 7 127719384 missense possibly damaging 0.83
R4652:Ctf2 UTSW 7 127719384 missense probably benign 0.00
R5519:Ctf2 UTSW 7 127719291 missense probably benign 0.07
R6436:Ctf2 UTSW 7 127719431 missense probably damaging 1.00
R7161:Ctf2 UTSW 7 127719304 missense probably damaging 1.00
Z1176:Ctf2 UTSW 7 127719456 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATAGCAGCCATGTTGCCCAAG -3'
(R):5'- ACCTGTGCAGCATCTGAAG -3'

Sequencing Primer
(F):5'- TAGGACTGCCAGGATTCA -3'
(R):5'- GTGAATGGTAGCTTCCTCTGGGAC -3'
Posted On2014-11-12