Incidental Mutation 'R2417:Itih3'
ID249042
Institutional Source Beutler Lab
Gene Symbol Itih3
Ensembl Gene ENSMUSG00000006522
Gene Nameinter-alpha trypsin inhibitor, heavy chain 3
SynonymsItih-3, Intin3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30908572-30923760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30917664 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 400 (T400I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000226547] [ENSMUST00000227995] [ENSMUST00000228114]
Predicted Effect probably benign
Transcript: ENSMUST00000006697
AA Change: T400I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: T400I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Blast:VWA 571 634 2e-21 BLAST
Pfam:ITI_HC_C 683 870 3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169620
Predicted Effect probably benign
Transcript: ENSMUST00000170415
AA Change: T400I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133027
Gene: ENSMUSG00000006522
AA Change: T400I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Pfam:ITI_HC_C 503 680 1.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226179
Predicted Effect probably benign
Transcript: ENSMUST00000226547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227181
Predicted Effect probably benign
Transcript: ENSMUST00000227995
AA Change: T400I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000228114
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Itih3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Itih3 APN 14 30909781 missense probably damaging 0.98
IGL01359:Itih3 APN 14 30917772 missense probably damaging 1.00
IGL01965:Itih3 APN 14 30915720 missense probably damaging 0.99
IGL02435:Itih3 APN 14 30915754 missense probably damaging 0.99
IGL02539:Itih3 APN 14 30912664 missense probably benign 0.03
IGL02637:Itih3 APN 14 30915660 missense probably benign 0.00
IGL02958:Itih3 APN 14 30913182 missense probably benign 0.00
IGL03253:Itih3 APN 14 30911923 critical splice donor site probably null
K2124:Itih3 UTSW 14 30912687 missense probably benign 0.40
R0321:Itih3 UTSW 14 30912106 missense probably damaging 0.99
R0466:Itih3 UTSW 14 30912874 critical splice donor site probably null
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1633:Itih3 UTSW 14 30917398 missense possibly damaging 0.46
R1982:Itih3 UTSW 14 30923583 unclassified probably benign
R2056:Itih3 UTSW 14 30909524 splice site probably null
R2077:Itih3 UTSW 14 30909835 missense possibly damaging 0.91
R3624:Itih3 UTSW 14 30914743 missense probably damaging 1.00
R3794:Itih3 UTSW 14 30918394 missense probably damaging 1.00
R4676:Itih3 UTSW 14 30918949 missense probably null 1.00
R4676:Itih3 UTSW 14 30921686 missense possibly damaging 0.91
R5198:Itih3 UTSW 14 30912649 missense probably benign 0.07
R5429:Itih3 UTSW 14 30923521 missense probably benign 0.00
R6379:Itih3 UTSW 14 30909724 missense probably damaging 1.00
R6740:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6752:Itih3 UTSW 14 30923489 missense possibly damaging 0.76
R6765:Itih3 UTSW 14 30909473 missense probably benign
R6785:Itih3 UTSW 14 30912615 critical splice donor site probably null
R6871:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6935:Itih3 UTSW 14 30912702 missense possibly damaging 0.82
R7133:Itih3 UTSW 14 30917698 missense probably damaging 1.00
R7419:Itih3 UTSW 14 30914773 missense probably benign 0.41
R7592:Itih3 UTSW 14 30908765 missense probably damaging 0.98
R7598:Itih3 UTSW 14 30917377 missense possibly damaging 0.95
R7662:Itih3 UTSW 14 30917330 missense probably benign 0.00
R8183:Itih3 UTSW 14 30909476 missense probably benign
Y5408:Itih3 UTSW 14 30921945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTCCACGGCTATGCTG -3'
(R):5'- CAACAGCCTTGTACTCTGGTG -3'

Sequencing Primer
(F):5'- GGAGACCTGGCTCTTTATATACAGAG -3'
(R):5'- TTGTACTCTGGTGCCCCAAGG -3'
Posted On2014-11-12