Incidental Mutation 'R2417:Ddhd1'
ID249043
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene NameDDHD domain containing 1
Synonyms9630061G18Rik, 4921528E07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2417 (G1)
Quality Score164
Status Not validated
Chromosome14
Chromosomal Location45588467-45658143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45657272 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 30 (L30P)
Ref Sequence ENSEMBL: ENSMUSP00000154065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286] [ENSMUST00000226301]
Predicted Effect probably damaging
Transcript: ENSMUST00000051310
AA Change: L247P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: L247P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087320
AA Change: L247P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: L247P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111828
AA Change: L247P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: L247P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147551
Predicted Effect probably damaging
Transcript: ENSMUST00000149286
AA Change: L247P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697
AA Change: L247P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175426
Predicted Effect probably damaging
Transcript: ENSMUST00000226301
AA Change: L30P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228352
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45616551 missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45629580 missense probably null 0.98
IGL02176:Ddhd1 APN 14 45616600 missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45605206 unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45620783 missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45610605 missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45610510 missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45610690 missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45595592 missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45601650 missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45605051 critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45605109 missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45610624 missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45608990 missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45610573 missense probably benign 0.00
R3756:Ddhd1 UTSW 14 45657263 missense probably damaging 1.00
R4541:Ddhd1 UTSW 14 45622856 nonsense probably null
R4737:Ddhd1 UTSW 14 45628821 intron probably benign
R5105:Ddhd1 UTSW 14 45657407 missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45602707 missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45602668 missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45619514 splice site probably null
R6218:Ddhd1 UTSW 14 45614176 missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45657232 frame shift probably null
R6787:Ddhd1 UTSW 14 45657519 missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45602681 missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45657806 missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45657753 missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45657231 missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45657647 missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45657470 missense probably damaging 0.96
Z1177:Ddhd1 UTSW 14 45657594 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGGCAGCAGCACTCTACTC -3'
(R):5'- AAGAAGACCTGGAAGCCCTTC -3'

Sequencing Primer
(F):5'- TCTACTCACCCAGGAGGC -3'
(R):5'- TACGACTCTCTGCGCATCGAG -3'
Posted On2014-11-12