Incidental Mutation 'R2417:Lrrc14'
ID249044
Institutional Source Beutler Lab
Gene Symbol Lrrc14
Ensembl Gene ENSMUSG00000033728
Gene Nameleucine rich repeat containing 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76710623-76717699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76713421 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 117 (L117Q)
Ref Sequence ENSEMBL: ENSMUSP00000115446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000049956] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735] [ENSMUST00000230724] [ENSMUST00000230544]
Predicted Effect probably damaging
Transcript: ENSMUST00000036423
AA Change: L117Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728
AA Change: L117Q

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000049956
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127208
AA Change: L117Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728
AA Change: L117Q

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136840
AA Change: L117Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728
AA Change: L117Q

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137649
AA Change: L117Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728
AA Change: L117Q

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably damaging
Transcript: ENSMUST00000155735
AA Change: L117Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728
AA Change: L117Q

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229360
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich repeat-containing protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Lrrc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Lrrc14 APN 15 76713742 missense probably damaging 0.99
IGL03213:Lrrc14 APN 15 76713783 missense possibly damaging 0.95
Sojourn UTSW 15 76713446 missense possibly damaging 0.91
Sumo UTSW 15 76713565 missense probably benign 0.17
R0302:Lrrc14 UTSW 15 76714352 missense probably benign 0.28
R3423:Lrrc14 UTSW 15 76713118 unclassified probably null
R3930:Lrrc14 UTSW 15 76713565 missense probably benign 0.17
R3931:Lrrc14 UTSW 15 76713565 missense probably benign 0.17
R4622:Lrrc14 UTSW 15 76716340 unclassified probably benign
R4863:Lrrc14 UTSW 15 76713362 unclassified probably null
R5290:Lrrc14 UTSW 15 76713943 missense probably benign 0.17
R5451:Lrrc14 UTSW 15 76713973 missense probably benign 0.01
R5950:Lrrc14 UTSW 15 76715310 unclassified probably benign
R6561:Lrrc14 UTSW 15 76713446 missense possibly damaging 0.91
R6609:Lrrc14 UTSW 15 76714253 missense probably benign
R7341:Lrrc14 UTSW 15 76714511 missense probably damaging 1.00
R7638:Lrrc14 UTSW 15 76713973 missense probably benign 0.01
R8046:Lrrc14 UTSW 15 76714531 missense possibly damaging 0.78
R8223:Lrrc14 UTSW 15 76714556 missense probably damaging 1.00
R8393:Lrrc14 UTSW 15 76714198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCAAGAAACAGAGGCTGGC -3'
(R):5'- AAGGAATGTGTACGAGGCCC -3'

Sequencing Primer
(F):5'- CATTTATCTAGGGGGCCCATAG -3'
(R):5'- TGTACGAGGCCCGGTTTAC -3'
Posted On2014-11-12