Incidental Mutation 'R2417:Ptprm'
ID249046
Institutional Source Beutler Lab
Gene Symbol Ptprm
Ensembl Gene ENSMUSG00000033278
Gene Nameprotein tyrosine phosphatase, receptor type, M
SynonymsRPTPmu
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location66666947-67354457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66944326 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 519 (T519P)
Ref Sequence ENSEMBL: ENSMUSP00000153662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037974
AA Change: T519P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: T519P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
MAM 22 184 2.81e-73 SMART
IG 191 279 2.1e-6 SMART
FN3 281 364 6.35e-4 SMART
FN3 380 468 2.81e-5 SMART
FN3 482 572 3.7e-5 SMART
transmembrane domain 743 764 N/A INTRINSIC
low complexity region 765 774 N/A INTRINSIC
PTPc 899 1156 5.26e-135 SMART
PTPc 1185 1450 9.46e-96 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223982
AA Change: T519P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224091
AA Change: T519P

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225688
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Ptprm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Ptprm APN 17 66817972 missense probably damaging 1.00
IGL01128:Ptprm APN 17 67042101 missense probably damaging 1.00
IGL01509:Ptprm APN 17 66762213 missense possibly damaging 0.95
IGL01785:Ptprm APN 17 66685623 missense probably damaging 1.00
IGL01912:Ptprm APN 17 67046118 missense probably benign 0.13
IGL01929:Ptprm APN 17 66690549 missense probably damaging 1.00
IGL01937:Ptprm APN 17 67046163 splice site probably benign
IGL01939:Ptprm APN 17 67063163 splice site probably benign
IGL02053:Ptprm APN 17 66693841 missense probably damaging 1.00
IGL02203:Ptprm APN 17 66953123 missense probably damaging 1.00
IGL02468:Ptprm APN 17 66814509 missense probably benign 0.02
IGL02500:Ptprm APN 17 66920048 missense probably damaging 0.99
IGL02542:Ptprm APN 17 66920150 missense probably benign
Becalming UTSW 17 66944332 splice site probably null
Pacifying UTSW 17 66683408 missense possibly damaging 0.74
R0674:Ptprm UTSW 17 67191341 missense possibly damaging 0.52
R0709:Ptprm UTSW 17 66944332 splice site probably null
R1054:Ptprm UTSW 17 67042318 missense probably damaging 1.00
R1522:Ptprm UTSW 17 66693871 missense possibly damaging 0.91
R1561:Ptprm UTSW 17 66940541 missense probably damaging 1.00
R1726:Ptprm UTSW 17 67042327 missense probably damaging 1.00
R1744:Ptprm UTSW 17 66689366 missense probably damaging 1.00
R1873:Ptprm UTSW 17 66688355 missense probably damaging 1.00
R1951:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1952:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1953:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1993:Ptprm UTSW 17 66747160 missense probably damaging 1.00
R2017:Ptprm UTSW 17 66957153 splice site probably null
R2266:Ptprm UTSW 17 66725851 splice site probably null
R2511:Ptprm UTSW 17 66693778 missense probably damaging 1.00
R3726:Ptprm UTSW 17 66956860 missense possibly damaging 0.91
R3824:Ptprm UTSW 17 66809575 missense probably benign 0.40
R4057:Ptprm UTSW 17 67075663 missense possibly damaging 0.93
R4113:Ptprm UTSW 17 66725813 missense probably damaging 1.00
R4559:Ptprm UTSW 17 66683408 missense possibly damaging 0.74
R4598:Ptprm UTSW 17 67095497 missense probably benign 0.00
R4742:Ptprm UTSW 17 66744751 nonsense probably null
R4974:Ptprm UTSW 17 66678067 missense probably benign 0.01
R5157:Ptprm UTSW 17 66957097 missense probably benign 0.09
R5433:Ptprm UTSW 17 66693473 missense probably damaging 1.00
R5509:Ptprm UTSW 17 66689358 missense probably damaging 1.00
R5586:Ptprm UTSW 17 66920196 missense probably damaging 1.00
R5820:Ptprm UTSW 17 66689465 missense probably damaging 1.00
R5867:Ptprm UTSW 17 67045981 splice site probably null
R6044:Ptprm UTSW 17 66693862 missense probably damaging 1.00
R6229:Ptprm UTSW 17 66688300 missense probably damaging 1.00
R6615:Ptprm UTSW 17 67353956 critical splice donor site probably null
R6969:Ptprm UTSW 17 66912418 missense possibly damaging 0.63
R7135:Ptprm UTSW 17 66944288 missense possibly damaging 0.93
R7161:Ptprm UTSW 17 66809627 missense probably benign 0.21
R7410:Ptprm UTSW 17 66693566 missense probably damaging 0.99
R7476:Ptprm UTSW 17 66725791 missense probably benign 0.01
R7789:Ptprm UTSW 17 67095539 missense probably damaging 1.00
R8027:Ptprm UTSW 17 66944205 missense probably damaging 1.00
R8089:Ptprm UTSW 17 66683488 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCAAGGCATAACTCATCAGTG -3'
(R):5'- ACCTACTGGCTCTAAGTCCC -3'

Sequencing Primer
(F):5'- TGATACCTGATATTTTTGTGGTGAAC -3'
(R):5'- TAAGTCCCTCCCTCTAGAAAGGTTAC -3'
Posted On2014-11-12