Incidental Mutation 'R2417:Cpsf7'
ID249048
Institutional Source Beutler Lab
Gene Symbol Cpsf7
Ensembl Gene ENSMUSG00000034820
Gene Namecleavage and polyadenylation specific factor 7
SynonymsC330017N18Rik, 5730453I16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10525244-10547735 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 10525968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025570] [ENSMUST00000038379]
Predicted Effect probably benign
Transcript: ENSMUST00000025570
SMART Domains Protein: ENSMUSP00000025570
Gene: ENSMUSG00000024668

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Sdh5 65 138 7.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038379
SMART Domains Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
RRM 83 158 7.31e-8 SMART
low complexity region 188 202 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 265 291 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 405 439 N/A INTRINSIC
low complexity region 454 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Cpsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cpsf7 APN 19 10539787 missense probably damaging 0.98
IGL00870:Cpsf7 APN 19 10539650 splice site probably null
IGL01883:Cpsf7 APN 19 10526023 missense possibly damaging 0.69
IGL02406:Cpsf7 APN 19 10531988 missense probably damaging 0.96
IGL02491:Cpsf7 APN 19 10539637 missense possibly damaging 0.92
IGL02990:Cpsf7 APN 19 10531795 missense probably benign
R0003:Cpsf7 UTSW 19 10539629 missense possibly damaging 0.88
R0540:Cpsf7 UTSW 19 10533318 nonsense probably null
R0633:Cpsf7 UTSW 19 10531782 missense probably benign 0.09
R0662:Cpsf7 UTSW 19 10526008 start codon destroyed probably null 0.77
R1309:Cpsf7 UTSW 19 10533467 critical splice donor site probably null
R1817:Cpsf7 UTSW 19 10535439 missense possibly damaging 0.89
R2004:Cpsf7 UTSW 19 10540709 missense probably damaging 1.00
R2286:Cpsf7 UTSW 19 10535296 missense probably damaging 0.99
R4374:Cpsf7 UTSW 19 10539637 missense probably damaging 1.00
R5788:Cpsf7 UTSW 19 10540718 missense possibly damaging 0.88
R5801:Cpsf7 UTSW 19 10539632 missense probably benign 0.02
R6823:Cpsf7 UTSW 19 10532884 nonsense probably null
R7371:Cpsf7 UTSW 19 10531839 missense probably benign 0.00
R7602:Cpsf7 UTSW 19 10535373 missense probably damaging 0.99
R8185:Cpsf7 UTSW 19 10536860 nonsense probably null
Z1177:Cpsf7 UTSW 19 10535518 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- TGAGGGCCCTCTCAGGAGT -3'
(R):5'- TACAGGGAATTATTTTGAGCTGAGAG -3'

Sequencing Primer
(F):5'- TCTCAGGAGTCGAGGCC -3'
(R):5'- TATTTTGAGCTGAGAGAGAAACCAC -3'
Posted On2014-11-12