Incidental Mutation 'R2418:Resp18'
ID249050
Institutional Source Beutler Lab
Gene Symbol Resp18
Ensembl Gene ENSMUSG00000033061
Gene Nameregulated endocrine-specific protein 18
Synonyms
MMRRC Submission 040380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2418 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75272199-75278415 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 75272311 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 176 (*176W)
Ref Sequence ENSEMBL: ENSMUSP00000043783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039534] [ENSMUST00000186229]
Predicted Effect probably null
Transcript: ENSMUST00000039534
AA Change: *176W
SMART Domains Protein: ENSMUSP00000043783
Gene: ENSMUSG00000033061
AA Change: *176W

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
RESP18 37 140 1.83e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186229
SMART Domains Protein: ENSMUSP00000140605
Gene: ENSMUSG00000033061

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
RESP18 37 118 1.06e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191531
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that is expressed mainly in the peripheral endocrine and neuroendocrine tissues and is regulated by physiological factors that include blood glucose and dopaminergic drugs. The encoded protein is found in the lumen of the endoplasmic reticulum and is degraded in the post-ER pre-Golgi compartment. Gene knockout experiments in mice demonstrate that this gene is essential for embryonic development with embryonic lethality occurring before embryonic day 9.5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acox3 A G 5: 35,604,638 N442S probably benign Het
Acp5 C A 9: 22,129,952 V60L probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Btd G A 14: 31,641,136 probably null Het
Cfap74 T A 4: 155,455,709 probably benign Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Col4a4 G T 1: 82,532,936 A205E unknown Het
Cwf19l1 T C 19: 44,131,472 T77A probably benign Het
Cyp2b9 A G 7: 26,186,707 T100A probably benign Het
Ddx24 A G 12: 103,417,737 L485P probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 E272V possibly damaging Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Elk3 T C 10: 93,284,827 N50S probably damaging Het
Fmo3 A T 1: 162,966,958 I181K probably benign Het
Golga3 T C 5: 110,201,868 I655T probably damaging Het
Hspa1l A T 17: 34,977,188 T68S probably benign Het
Itgax C T 7: 128,142,333 R839W probably damaging Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Kmt5b C T 19: 3,807,266 A318V probably benign Het
Krt78 T C 15: 101,946,634 Y914C probably benign Het
Lactb2 T C 1: 13,660,339 T38A possibly damaging Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Magi1 T C 6: 93,745,910 D329G probably damaging Het
Map3k5 T A 10: 20,110,857 V939E probably benign Het
Mcm8 C T 2: 132,824,738 A233V probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Mical2 G T 7: 112,320,734 probably null Het
Nudt13 A G 14: 20,311,513 E219G probably damaging Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr449 A G 6: 42,838,049 H56R probably benign Het
Olfr653 A T 7: 104,579,934 H96L probably benign Het
Osbpl7 A C 11: 97,059,178 D395A probably benign Het
Osbpl9 A G 4: 109,066,218 C495R probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Pcnx4 T A 12: 72,556,263 F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 P158S probably damaging Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Ptbp1 T C 10: 79,859,677 Y187H probably damaging Het
Rps6ka2 A C 17: 7,299,339 Q665H possibly damaging Het
Rtn1 T C 12: 72,304,278 T386A probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Scn1a T C 2: 66,273,843 N1663S probably damaging Het
Smyd1 A T 6: 71,239,553 I70N probably damaging Het
Tas2r105 T C 6: 131,687,447 E6G probably damaging Het
Tchh G T 3: 93,445,629 R792L unknown Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem184b A G 15: 79,365,943 Y211H possibly damaging Het
Top3a C A 11: 60,748,016 G551V possibly damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Wdr66 A C 5: 123,254,268 probably benign Het
Other mutations in Resp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02182:Resp18 APN 1 75273971 missense probably benign 0.01
R5772:Resp18 UTSW 1 75274000 missense possibly damaging 0.50
R7574:Resp18 UTSW 1 75273971 missense probably benign 0.01
R7614:Resp18 UTSW 1 75278238 missense probably damaging 1.00
R7895:Resp18 UTSW 1 75278202 missense probably null 0.71
Z1088:Resp18 UTSW 1 75278291 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAGTCTTTGACCAAGCATTCAGAG -3'
(R):5'- TCACCATCGGGAAGGCTTAC -3'

Sequencing Primer
(F):5'- CAAGCATTCAGAGCTTGGTC -3'
(R):5'- CATCGGGAAGGCTTACTCAGATC -3'
Posted On2014-11-12