Incidental Mutation 'R2418:Olfr1212'
ID249055
Institutional Source Beutler Lab
Gene Symbol Olfr1212
Ensembl Gene ENSMUSG00000048226
Gene Nameolfactory receptor 1212
SynonymsGA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17
MMRRC Submission 040380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2418 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88953969-88961313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88959036 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 190 (N190S)
Ref Sequence ENSEMBL: ENSMUSP00000149781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055895] [ENSMUST00000215781]
Predicted Effect probably benign
Transcript: ENSMUST00000055895
AA Change: N190S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052837
Gene: ENSMUSG00000048226
AA Change: N190S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-46 PFAM
Pfam:7tm_1 39 286 7.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215781
AA Change: N190S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acox3 A G 5: 35,604,638 N442S probably benign Het
Acp5 C A 9: 22,129,952 V60L probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Btd G A 14: 31,641,136 probably null Het
Cfap74 T A 4: 155,455,709 probably benign Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Col4a4 G T 1: 82,532,936 A205E unknown Het
Cwf19l1 T C 19: 44,131,472 T77A probably benign Het
Cyp2b9 A G 7: 26,186,707 T100A probably benign Het
Ddx24 A G 12: 103,417,737 L485P probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 E272V possibly damaging Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Elk3 T C 10: 93,284,827 N50S probably damaging Het
Fmo3 A T 1: 162,966,958 I181K probably benign Het
Golga3 T C 5: 110,201,868 I655T probably damaging Het
Hspa1l A T 17: 34,977,188 T68S probably benign Het
Itgax C T 7: 128,142,333 R839W probably damaging Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Kmt5b C T 19: 3,807,266 A318V probably benign Het
Krt78 T C 15: 101,946,634 Y914C probably benign Het
Lactb2 T C 1: 13,660,339 T38A possibly damaging Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Magi1 T C 6: 93,745,910 D329G probably damaging Het
Map3k5 T A 10: 20,110,857 V939E probably benign Het
Mcm8 C T 2: 132,824,738 A233V probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Mical2 G T 7: 112,320,734 probably null Het
Nudt13 A G 14: 20,311,513 E219G probably damaging Het
Olfr449 A G 6: 42,838,049 H56R probably benign Het
Olfr653 A T 7: 104,579,934 H96L probably benign Het
Osbpl7 A C 11: 97,059,178 D395A probably benign Het
Osbpl9 A G 4: 109,066,218 C495R probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Pcnx4 T A 12: 72,556,263 F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 P158S probably damaging Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Ptbp1 T C 10: 79,859,677 Y187H probably damaging Het
Resp18 T C 1: 75,272,311 *176W probably null Het
Rps6ka2 A C 17: 7,299,339 Q665H possibly damaging Het
Rtn1 T C 12: 72,304,278 T386A probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Scn1a T C 2: 66,273,843 N1663S probably damaging Het
Smyd1 A T 6: 71,239,553 I70N probably damaging Het
Tas2r105 T C 6: 131,687,447 E6G probably damaging Het
Tchh G T 3: 93,445,629 R792L unknown Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem184b A G 15: 79,365,943 Y211H possibly damaging Het
Top3a C A 11: 60,748,016 G551V possibly damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Wdr66 A C 5: 123,254,268 probably benign Het
Other mutations in Olfr1212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1212 APN 2 88958766 missense probably damaging 0.98
IGL01398:Olfr1212 APN 2 88958849 missense probably damaging 1.00
IGL01537:Olfr1212 APN 2 88958541 missense probably benign 0.00
IGL02197:Olfr1212 APN 2 88958684 missense probably benign 0.05
IGL02557:Olfr1212 APN 2 88958681 missense probably benign 0.00
R0276:Olfr1212 UTSW 2 88958755 nonsense probably null
R0568:Olfr1212 UTSW 2 88959043 nonsense probably null
R0699:Olfr1212 UTSW 2 88958616 missense probably benign 0.31
R1101:Olfr1212 UTSW 2 88958984 missense possibly damaging 0.60
R1205:Olfr1212 UTSW 2 88958588 missense probably benign 0.00
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1845:Olfr1212 UTSW 2 88958867 missense probably damaging 0.99
R2031:Olfr1212 UTSW 2 88959299 missense probably benign 0.19
R2419:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R3781:Olfr1212 UTSW 2 88958747 nonsense probably null
R4049:Olfr1212 UTSW 2 88959273 missense probably benign 0.09
R4440:Olfr1212 UTSW 2 88959341 missense probably benign 0.22
R4583:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4646:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4648:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4674:Olfr1212 UTSW 2 88958872 missense probably damaging 0.98
R4851:Olfr1212 UTSW 2 88958586 missense probably damaging 1.00
R4971:Olfr1212 UTSW 2 88958519 missense probably damaging 1.00
R5610:Olfr1212 UTSW 2 88958826 missense probably damaging 1.00
R5805:Olfr1212 UTSW 2 88958641 missense possibly damaging 0.50
R5887:Olfr1212 UTSW 2 88958754 missense possibly damaging 0.60
R6023:Olfr1212 UTSW 2 88958715 missense possibly damaging 0.76
R6118:Olfr1212 UTSW 2 88959118 nonsense probably null
R7490:Olfr1212 UTSW 2 88959048 missense probably benign 0.00
R7542:Olfr1212 UTSW 2 88958775 missense probably benign 0.01
R7612:Olfr1212 UTSW 2 88958505 missense probably damaging 1.00
Z1177:Olfr1212 UTSW 2 88959377 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTAATATCCATGGCTTATGACCG -3'
(R):5'- CACAACAGCAATGTGGGATCC -3'

Sequencing Primer
(F):5'- CCATGGCTTATGACCGATATGTAGC -3'
(R):5'- TCCACAAGTAGAGAGAGCTTTC -3'
Posted On2014-11-12