Mutagenetix > Incidental Mutations

Incidental Mutation 'R0305:Gad1-ps'

24907

Institutional Source

Beutler Lab

Gene Symbol

Gad1-ps

Ensembl Gene

ENSMUSG00000090665

Gene Name

glutamate decarboxylase 1, pseudogene

Synonyms

Gad-1ps

MMRRC Submission

038516-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R0305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99443838-99447029 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to G at 99444803 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167243

SMART Domains

Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	1	368	4.3e-153	PFAM
Pfam:Beta_elim_lyase	91	436	7.3e-8	PFAM
Pfam:Aminotran_5	130	370	4.7e-7	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	G	A	7: 27,574,636	R183Q	probably damaging	Het
Abca5	A	G	11: 110,273,311		probably benign	Het
Ada	T	C	2: 163,728,157	K312R	probably benign	Het
Adam21	C	A	12: 81,560,285	K234N	possibly damaging	Het
Afdn	T	A	17: 13,888,514		probably null	Het
Aimp1	T	G	3: 132,673,986	K132Q	possibly damaging	Het
Aldh16a1	C	T	7: 45,147,979	R135Q	probably damaging	Het
Alox12b	A	T	11: 69,167,379	Y519F	probably benign	Het
Alppl2	T	C	1: 87,089,602	E25G	probably benign	Het
Apob	A	T	12: 8,012,210	N3531I	probably damaging	Het
Arhgap23	T	C	11: 97,501,109	L321P	probably damaging	Het
Cab39l	C	T	14: 59,519,579	Q137*	probably null	Het
Cenpo	A	T	12: 4,216,660	H149Q	possibly damaging	Het
Cpt1a	A	G	19: 3,378,455	T610A	probably benign	Het
Dcbld2	A	G	16: 58,448,939	T271A	probably damaging	Het
Dcps	A	G	9: 35,175,769		probably null	Het
Dnaic2	A	G	11: 114,752,894	D462G	probably benign	Het
Dsg2	T	A	18: 20,582,695		probably benign	Het
Eomes	A	T	9: 118,484,757	E623D	probably benign	Het
Fam19a5	T	A	15: 87,720,508	I83N	probably damaging	Het
Fras1	A	T	5: 96,596,888	H594L	probably benign	Het
Galk2	A	G	2: 125,887,888	Y63C	probably damaging	Het
H2-T10	A	G	17: 36,119,368	L227P	probably damaging	Het
Itgb4	T	G	11: 115,979,412	C73G	probably damaging	Het
Itpr2	T	C	6: 146,311,103	H1472R	possibly damaging	Het
Kcnh5	C	T	12: 75,114,397	A246T	probably benign	Het
Kpna6	G	T	4: 129,649,249	R458S	probably benign	Het
Lifr	A	G	15: 7,177,501	T498A	probably damaging	Het
Lrrd1	T	G	5: 3,865,707	I768S	probably damaging	Het
Map2	T	C	1: 66,413,094	V223A	probably benign	Het
Nod2	G	A	8: 88,665,323	A731T	probably damaging	Het
Nrxn2	G	A	19: 6,519,283	C1403Y	probably damaging	Het
Nxph1	A	T	6: 9,247,754	I242F	probably damaging	Het
Olfr507	G	A	7: 108,622,585	V258I	probably benign	Het
Pgr	A	G	9: 8,902,087		probably benign	Het
Pik3cb	A	G	9: 99,064,076	S566P	possibly damaging	Het
Sema4d	T	C	13: 51,712,728	Y242C	probably damaging	Het
Sftpc	T	A	14: 70,524,078		probably benign	Het
Sh3tc1	T	G	5: 35,723,999	E33D	probably benign	Het
Slc17a5	A	G	9: 78,557,537	L344P	probably benign	Het
Slc39a5	T	A	10: 128,398,396		probably benign	Het
Slc7a13	C	A	4: 19,839,401	H335N	probably benign	Het
Slco1a4	A	C	6: 141,817,753	N412K	possibly damaging	Het
Sox1	A	T	8: 12,396,736	T126S	probably damaging	Het
Specc1l	T	A	10: 75,245,829	V353E	probably damaging	Het
Stat5b	T	C	11: 100,802,503	E104G	probably benign	Het
Sult4a1	A	G	15: 84,086,667	V179A	probably damaging	Het
Tbl3	G	A	17: 24,705,461	R134C	probably damaging	Het
Tmem256	T	A	11: 69,838,911		probably benign	Het
Tmigd1	A	G	11: 76,907,134	T101A	probably damaging	Het
Unc5b	C	A	10: 60,779,658		probably benign	Het
Unc79	T	A	12: 103,113,200	S1679T	probably benign	Het
Vmn2r1	T	G	3: 64,089,666	C248G	probably damaging	Het
Vmn2r57	T	C	7: 41,427,543	I400V	probably benign	Het
Vwa8	T	A	14: 79,009,273	L685H	probably damaging	Het
Yeats4	A	G	10: 117,215,836	F172S	probably damaging	Het
Zfpm2	T	G	15: 40,774,035		probably benign	Het

Other mutations in Gad1-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00963:Gad1-ps	APN	10	99445448	exon	noncoding transcript
IGL01301:Gad1-ps	APN	10	99445151	exon	noncoding transcript
IGL01394:Gad1-ps	APN	10	99445562	exon	noncoding transcript
IGL02220:Gad1-ps	APN	10	99445322	exon	noncoding transcript
IGL02240:Gad1-ps	APN	10	99444958	exon	noncoding transcript
IGL03406:Gad1-ps	APN	10	99444779	exon	noncoding transcript
ANU18:Gad1-ps	UTSW	10	99445151	exon	noncoding transcript
R0446:Gad1-ps	UTSW	10	99445521	exon	noncoding transcript
R0538:Gad1-ps	UTSW	10	99444992	exon	noncoding transcript
R1511:Gad1-ps	UTSW	10	99445469	exon	noncoding transcript
R1734:Gad1-ps	UTSW	10	99445775	exon	noncoding transcript
R1745:Gad1-ps	UTSW	10	99445524	exon	noncoding transcript
R1886:Gad1-ps	UTSW	10	99445582	exon	noncoding transcript
R3111:Gad1-ps	UTSW	10	99444521	exon	noncoding transcript
R3617:Gad1-ps	UTSW	10	99445398	exon	noncoding transcript
R5042:Gad1-ps	UTSW	10	99445654	exon	noncoding transcript
R5223:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5234:Gad1-ps	UTSW	10	99445326	exon	noncoding transcript
R5275:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5295:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5334:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5335:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5336:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5337:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5396:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5397:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5399:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5428:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5429:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5431:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5661:Gad1-ps	UTSW	10	99445039	exon	noncoding transcript
R5667:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5671:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5885:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5886:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GGTTTTGGATTTCCACCACCCACAC -3'
(R):5'- AAGCTCCGTAAACAGTCGTGCC -3'

Sequencing Primer
(F):5'- GTTGACTGTAGAGACACCCTG -3'
(R):5'- GAATTTTTGCCTCTAAATCAGCCG -3'

Posted On

2013-04-16