Incidental Mutation 'R2418:Itgax'
ID 249074
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission 040380-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R2418 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127741505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 839 (R839W)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
AlphaFold Q9QXH4
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: R839W

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: R839W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,328,001 (GRCm39) A768T probably benign Het
Acox3 A G 5: 35,761,982 (GRCm39) N442S probably benign Het
Acp5 C A 9: 22,041,248 (GRCm39) V60L probably benign Het
Arap3 T C 18: 38,122,997 (GRCm39) D501G probably damaging Het
Bcorl1 A G X: 47,459,418 (GRCm39) T425A probably damaging Het
Btd G A 14: 31,363,093 (GRCm39) probably null Het
Cfap251 A C 5: 123,392,331 (GRCm39) probably benign Het
Cfap74 T A 4: 155,540,166 (GRCm39) probably benign Het
Cnot8 G A 11: 58,006,136 (GRCm39) G222R probably damaging Het
Col4a4 G T 1: 82,510,657 (GRCm39) A205E unknown Het
Cwf19l1 T C 19: 44,119,911 (GRCm39) T77A probably benign Het
Cyp2b9 A G 7: 25,886,132 (GRCm39) T100A probably benign Het
Ddx24 A G 12: 103,383,996 (GRCm39) L485P probably damaging Het
Dnah9 A T 11: 65,986,241 (GRCm39) L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 (GRCm38) E272V possibly damaging Het
Dscc1 G A 15: 54,946,820 (GRCm39) R302* probably null Het
Elk3 T C 10: 93,120,689 (GRCm39) N50S probably damaging Het
Fmo3 A T 1: 162,794,527 (GRCm39) I181K probably benign Het
Golga3 T C 5: 110,349,734 (GRCm39) I655T probably damaging Het
Hspa1l A T 17: 35,196,164 (GRCm39) T68S probably benign Het
Itk A G 11: 46,229,044 (GRCm39) F379L probably damaging Het
Kif7 C A 7: 79,348,441 (GRCm39) R1300L probably benign Het
Klkb1 A T 8: 45,742,149 (GRCm39) D43E possibly damaging Het
Kmt5b C T 19: 3,857,266 (GRCm39) A318V probably benign Het
Krt78 T C 15: 101,855,069 (GRCm39) Y914C probably benign Het
Lactb2 T C 1: 13,730,563 (GRCm39) T38A possibly damaging Het
Lmbr1l A C 15: 98,805,418 (GRCm39) F361C possibly damaging Het
Magi1 T C 6: 93,722,891 (GRCm39) D329G probably damaging Het
Map3k5 T A 10: 19,986,603 (GRCm39) V939E probably benign Het
Mcm8 C T 2: 132,666,658 (GRCm39) A233V probably benign Het
Mcur1 C T 13: 43,703,013 (GRCm39) V241M possibly damaging Het
Mical2 G T 7: 111,919,941 (GRCm39) probably null Het
Nudt13 A G 14: 20,361,581 (GRCm39) E219G probably damaging Het
Or4c107 A G 2: 88,789,380 (GRCm39) N190S probably benign Het
Or52d3 A T 7: 104,229,141 (GRCm39) H96L probably benign Het
Or6b1 A G 6: 42,814,983 (GRCm39) H56R probably benign Het
Osbpl7 A C 11: 96,950,004 (GRCm39) D395A probably benign Het
Osbpl9 A G 4: 108,923,415 (GRCm39) C495R probably damaging Het
Pcdhac1 T C 18: 37,224,381 (GRCm39) L398P probably benign Het
Pcnx4 T A 12: 72,603,037 (GRCm39) F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 (GRCm39) P158S probably damaging Het
Pkd1l3 A C 8: 110,397,353 (GRCm39) *2152C probably null Het
Plcxd3 G T 15: 4,604,245 (GRCm39) K284N probably benign Het
Plxnb2 A G 15: 89,045,272 (GRCm39) V1058A possibly damaging Het
Ptbp1 T C 10: 79,695,511 (GRCm39) Y187H probably damaging Het
Resp18 T C 1: 75,248,955 (GRCm39) *176W probably null Het
Rps6ka2 A C 17: 7,566,738 (GRCm39) Q665H possibly damaging Het
Rtn1 T C 12: 72,351,052 (GRCm39) T386A probably benign Het
Samt2 A T X: 153,358,223 (GRCm39) probably null Het
Scn1a T C 2: 66,104,187 (GRCm39) N1663S probably damaging Het
Smyd1 A T 6: 71,216,537 (GRCm39) I70N probably damaging Het
Tas2r105 T C 6: 131,664,410 (GRCm39) E6G probably damaging Het
Tchh G T 3: 93,352,936 (GRCm39) R792L unknown Het
Tenm3 C T 8: 48,729,693 (GRCm39) D1438N possibly damaging Het
Tmem184b A G 15: 79,250,143 (GRCm39) Y211H possibly damaging Het
Top3a C A 11: 60,638,842 (GRCm39) G551V possibly damaging Het
Vmn1r168 A T 7: 23,240,824 (GRCm39) N227I probably benign Het
Vmn1r203 T A 13: 22,709,004 (GRCm39) S262T possibly damaging Het
Vmn1r204 T G 13: 22,740,420 (GRCm39) L17R probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2019:Itgax UTSW 7 127,747,698 (GRCm39) missense probably benign
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5733:Itgax UTSW 7 127,739,647 (GRCm39) missense probably damaging 0.99
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R5964:Itgax UTSW 7 127,739,619 (GRCm39) missense probably damaging 1.00
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,747,025 (GRCm39) missense probably benign 0.16
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8730:Itgax UTSW 7 127,739,066 (GRCm39) critical splice acceptor site probably null
R8742:Itgax UTSW 7 127,743,795 (GRCm39) missense probably benign 0.28
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9149:Itgax UTSW 7 127,730,641 (GRCm39) missense probably benign 0.01
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTCACACGCTCATCTGGAG -3'
(R):5'- TCTTCAAAACACGGTCCCAG -3'

Sequencing Primer
(F):5'- TAGCCTCAGTCCCAGGATC -3'
(R):5'- CACGGTCCCAGAAGTACAAG -3'
Posted On 2014-11-12