Incidental Mutation 'R0305:Yeats4'
ID24908
Institutional Source Beutler Lab
Gene Symbol Yeats4
Ensembl Gene ENSMUSG00000020171
Gene NameYEATS domain containing 4
Synonyms4930573H17Rik, NuBI-1, GAS41, B230215M10Rik
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R0305 (G1)
Quality Score169
Status Validated
Chromosome10
Chromosomal Location117215221-117224507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117215836 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 172 (F172S)
Ref Sequence ENSEMBL: ENSMUSP00000020382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020382] [ENSMUST00000218887]
Predicted Effect probably damaging
Transcript: ENSMUST00000020382
AA Change: F172S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020382
Gene: ENSMUSG00000020171
AA Change: F172S

DomainStartEndE-ValueType
Pfam:YEATS 44 124 4.6e-38 PFAM
low complexity region 152 163 N/A INTRINSIC
coiled coil region 178 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219609
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleoli. It has high sequence homology to human MLLT1, and yeast and human MLLT3 proteins. Both MLLT1 and MLLT3 proteins belong to a class of transcription factors, indicating that the encoded protein might also represent a transcription factor. This protein is thought to be required for RNA transcription. This gene has been shown to be amplified in tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Yeats4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Yeats4 APN 10 117215811 missense probably benign 0.01
R1606:Yeats4 UTSW 10 117217439 missense probably damaging 1.00
R1703:Yeats4 UTSW 10 117215723 missense probably benign
R1907:Yeats4 UTSW 10 117215731 missense probably benign 0.17
R3156:Yeats4 UTSW 10 117222281 missense probably benign 0.11
R3625:Yeats4 UTSW 10 117220368 missense probably benign 0.08
R5687:Yeats4 UTSW 10 117215680 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGGAGTCCTCTCTGAGAAAGC -3'
(R):5'- TCAAAGTCAACCGTGAGTTAGCAGC -3'

Sequencing Primer
(F):5'- TACCGCCAGTTGCTCAAATG -3'
(R):5'- GTTCAGTGCTCTGTCTCCAT -3'
Posted On2013-04-16