Incidental Mutation 'R2418:Plxnb2'
ID249104
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission 040380-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R2418 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89161069 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1058 (V1058A)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060808
AA Change: V1058A

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: V1058A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109331
AA Change: V1058A

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: V1058A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230393
Meta Mutation Damage Score 0.1419 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acox3 A G 5: 35,604,638 N442S probably benign Het
Acp5 C A 9: 22,129,952 V60L probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Btd G A 14: 31,641,136 probably null Het
Cfap74 T A 4: 155,455,709 probably benign Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Col4a4 G T 1: 82,532,936 A205E unknown Het
Cwf19l1 T C 19: 44,131,472 T77A probably benign Het
Cyp2b9 A G 7: 26,186,707 T100A probably benign Het
Ddx24 A G 12: 103,417,737 L485P probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 E272V possibly damaging Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Elk3 T C 10: 93,284,827 N50S probably damaging Het
Fmo3 A T 1: 162,966,958 I181K probably benign Het
Golga3 T C 5: 110,201,868 I655T probably damaging Het
Hspa1l A T 17: 34,977,188 T68S probably benign Het
Itgax C T 7: 128,142,333 R839W probably damaging Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Kmt5b C T 19: 3,807,266 A318V probably benign Het
Krt78 T C 15: 101,946,634 Y914C probably benign Het
Lactb2 T C 1: 13,660,339 T38A possibly damaging Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Magi1 T C 6: 93,745,910 D329G probably damaging Het
Map3k5 T A 10: 20,110,857 V939E probably benign Het
Mcm8 C T 2: 132,824,738 A233V probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Mical2 G T 7: 112,320,734 probably null Het
Nudt13 A G 14: 20,311,513 E219G probably damaging Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr449 A G 6: 42,838,049 H56R probably benign Het
Olfr653 A T 7: 104,579,934 H96L probably benign Het
Osbpl7 A C 11: 97,059,178 D395A probably benign Het
Osbpl9 A G 4: 109,066,218 C495R probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Pcnx4 T A 12: 72,556,263 F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 P158S probably damaging Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Ptbp1 T C 10: 79,859,677 Y187H probably damaging Het
Resp18 T C 1: 75,272,311 *176W probably null Het
Rps6ka2 A C 17: 7,299,339 Q665H possibly damaging Het
Rtn1 T C 12: 72,304,278 T386A probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Scn1a T C 2: 66,273,843 N1663S probably damaging Het
Smyd1 A T 6: 71,239,553 I70N probably damaging Het
Tas2r105 T C 6: 131,687,447 E6G probably damaging Het
Tchh G T 3: 93,445,629 R792L unknown Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem184b A G 15: 79,365,943 Y211H possibly damaging Het
Top3a C A 11: 60,748,016 G551V possibly damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Wdr66 A C 5: 123,254,268 probably benign Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGAGCTTGTTGACCTGC -3'
(R):5'- ATGGTTGTCATCGCTGAGCC -3'

Sequencing Primer
(F):5'- GACCTGCTTTTTGACGCCAC -3'
(R):5'- GTCATCGCTGAGCCCTTGC -3'
Posted On2014-11-12