Mutagenetix > Incidental Mutations

Incidental Mutation 'R2418:Plxnb2'

249104

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

040380-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R2418 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89161069 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1058 (V1058A)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060808
AA Change: V1058A

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: V1058A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109331
AA Change: V1058A

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: V1058A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230393

Meta Mutation Damage Score

0.1419

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,437,989	A768T	probably benign	Het
Acox3	A	G	5: 35,604,638	N442S	probably benign	Het
Acp5	C	A	9: 22,129,952	V60L	probably benign	Het
Arap3	T	C	18: 37,989,944	D501G	probably damaging	Het
Bcorl1	A	G	X: 48,370,541	T425A	probably damaging	Het
Btd	G	A	14: 31,641,136		probably null	Het
Cfap74	T	A	4: 155,455,709		probably benign	Het
Cnot8	G	A	11: 58,115,310	G222R	probably damaging	Het
Col4a4	G	T	1: 82,532,936	A205E	unknown	Het
Cwf19l1	T	C	19: 44,131,472	T77A	probably benign	Het
Cyp2b9	A	G	7: 26,186,707	T100A	probably benign	Het
Ddx24	A	G	12: 103,417,737	L485P	probably damaging	Het
Dnah9	A	T	11: 66,095,415	L1131*	probably null	Het
Dnase1l3	T	A	14: 7,968,089	E272V	possibly damaging	Het
Dscc1	G	A	15: 55,083,424	R302*	probably null	Het
Elk3	T	C	10: 93,284,827	N50S	probably damaging	Het
Fmo3	A	T	1: 162,966,958	I181K	probably benign	Het
Golga3	T	C	5: 110,201,868	I655T	probably damaging	Het
Hspa1l	A	T	17: 34,977,188	T68S	probably benign	Het
Itgax	C	T	7: 128,142,333	R839W	probably damaging	Het
Itk	A	G	11: 46,338,217	F379L	probably damaging	Het
Kif7	C	A	7: 79,698,693	R1300L	probably benign	Het
Klkb1	A	T	8: 45,289,112	D43E	possibly damaging	Het
Kmt5b	C	T	19: 3,807,266	A318V	probably benign	Het
Krt78	T	C	15: 101,946,634	Y914C	probably benign	Het
Lactb2	T	C	1: 13,660,339	T38A	possibly damaging	Het
Lmbr1l	A	C	15: 98,907,537	F361C	possibly damaging	Het
Magi1	T	C	6: 93,745,910	D329G	probably damaging	Het
Map3k5	T	A	10: 20,110,857	V939E	probably benign	Het
Mcm8	C	T	2: 132,824,738	A233V	probably benign	Het
Mcur1	C	T	13: 43,549,537	V241M	possibly damaging	Het
Mical2	G	T	7: 112,320,734		probably null	Het
Nudt13	A	G	14: 20,311,513	E219G	probably damaging	Het
Olfr1212	A	G	2: 88,959,036	N190S	probably benign	Het
Olfr449	A	G	6: 42,838,049	H56R	probably benign	Het
Olfr653	A	T	7: 104,579,934	H96L	probably benign	Het
Osbpl7	A	C	11: 97,059,178	D395A	probably benign	Het
Osbpl9	A	G	4: 109,066,218	C495R	probably damaging	Het
Pcdhac1	T	C	18: 37,091,328	L398P	probably benign	Het
Pcnx4	T	A	12: 72,556,263	F433Y	probably damaging	Het
Pdp1	G	A	4: 11,961,838	P158S	probably damaging	Het
Pkd1l3	A	C	8: 109,670,721	*2152C	probably null	Het
Plcxd3	G	T	15: 4,574,763	K284N	probably benign	Het
Ptbp1	T	C	10: 79,859,677	Y187H	probably damaging	Het
Resp18	T	C	1: 75,272,311	*176W	probably null	Het
Rps6ka2	A	C	17: 7,299,339	Q665H	possibly damaging	Het
Rtn1	T	C	12: 72,304,278	T386A	probably benign	Het
Samt2	A	T	X: 154,575,227		probably null	Het
Scn1a	T	C	2: 66,273,843	N1663S	probably damaging	Het
Smyd1	A	T	6: 71,239,553	I70N	probably damaging	Het
Tas2r105	T	C	6: 131,687,447	E6G	probably damaging	Het
Tchh	G	T	3: 93,445,629	R792L	unknown	Het
Tenm3	C	T	8: 48,276,658	D1438N	possibly damaging	Het
Tmem184b	A	G	15: 79,365,943	Y211H	possibly damaging	Het
Top3a	C	A	11: 60,748,016	G551V	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,399	N227I	probably benign	Het
Vmn1r203	T	A	13: 22,524,834	S262T	possibly damaging	Het
Vmn1r204	T	G	13: 22,556,250	L17R	probably damaging	Het
Wdr66	A	C	5: 123,254,268		probably benign	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATGAGCTTGTTGACCTGC -3'
(R):5'- ATGGTTGTCATCGCTGAGCC -3'

Sequencing Primer
(F):5'- GACCTGCTTTTTGACGCCAC -3'
(R):5'- GTCATCGCTGAGCCCTTGC -3'

Posted On

2014-11-12