Incidental Mutation 'R2418:Lmbr1l'
ID249106
Institutional Source Beutler Lab
Gene Symbol Lmbr1l
Ensembl Gene ENSMUSG00000022999
Gene Namelimb region 1 like
Synonyms1110013E13Rik, D15Ertd735e
MMRRC Submission 040380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2418 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98903917-98918231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98907537 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 361 (F361C)
Ref Sequence ENSEMBL: ENSMUSP00000023736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023736] [ENSMUST00000109127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023736
AA Change: F361C

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: F361C

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109127
SMART Domains Protein: ENSMUSP00000104755
Gene: ENSMUSG00000022999

DomainStartEndE-ValueType
Pfam:LMBR1 1 324 6.3e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231087
Meta Mutation Damage Score 0.4104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acox3 A G 5: 35,604,638 N442S probably benign Het
Acp5 C A 9: 22,129,952 V60L probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Btd G A 14: 31,641,136 probably null Het
Cfap74 T A 4: 155,455,709 probably benign Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Col4a4 G T 1: 82,532,936 A205E unknown Het
Cwf19l1 T C 19: 44,131,472 T77A probably benign Het
Cyp2b9 A G 7: 26,186,707 T100A probably benign Het
Ddx24 A G 12: 103,417,737 L485P probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dnase1l3 T A 14: 7,968,089 E272V possibly damaging Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Elk3 T C 10: 93,284,827 N50S probably damaging Het
Fmo3 A T 1: 162,966,958 I181K probably benign Het
Golga3 T C 5: 110,201,868 I655T probably damaging Het
Hspa1l A T 17: 34,977,188 T68S probably benign Het
Itgax C T 7: 128,142,333 R839W probably damaging Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Kmt5b C T 19: 3,807,266 A318V probably benign Het
Krt78 T C 15: 101,946,634 Y914C probably benign Het
Lactb2 T C 1: 13,660,339 T38A possibly damaging Het
Magi1 T C 6: 93,745,910 D329G probably damaging Het
Map3k5 T A 10: 20,110,857 V939E probably benign Het
Mcm8 C T 2: 132,824,738 A233V probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Mical2 G T 7: 112,320,734 probably null Het
Nudt13 A G 14: 20,311,513 E219G probably damaging Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr449 A G 6: 42,838,049 H56R probably benign Het
Olfr653 A T 7: 104,579,934 H96L probably benign Het
Osbpl7 A C 11: 97,059,178 D395A probably benign Het
Osbpl9 A G 4: 109,066,218 C495R probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Pcnx4 T A 12: 72,556,263 F433Y probably damaging Het
Pdp1 G A 4: 11,961,838 P158S probably damaging Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Ptbp1 T C 10: 79,859,677 Y187H probably damaging Het
Resp18 T C 1: 75,272,311 *176W probably null Het
Rps6ka2 A C 17: 7,299,339 Q665H possibly damaging Het
Rtn1 T C 12: 72,304,278 T386A probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Scn1a T C 2: 66,273,843 N1663S probably damaging Het
Smyd1 A T 6: 71,239,553 I70N probably damaging Het
Tas2r105 T C 6: 131,687,447 E6G probably damaging Het
Tchh G T 3: 93,445,629 R792L unknown Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem184b A G 15: 79,365,943 Y211H possibly damaging Het
Top3a C A 11: 60,748,016 G551V possibly damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Wdr66 A C 5: 123,254,268 probably benign Het
Other mutations in Lmbr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98904785 missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98917891 missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98917896 missense probably damaging 0.96
finch UTSW 15 98909386 critical splice donor site probably null
Gooseberry UTSW 15 98912427 missense probably damaging 0.99
morula UTSW 15 98904791 missense probably damaging 1.00
strawberry UTSW 15 98909263 nonsense probably null
R0310:Lmbr1l UTSW 15 98908773 splice site probably benign
R1778:Lmbr1l UTSW 15 98912476 missense probably damaging 1.00
R2419:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98908720 missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98909263 nonsense probably null
R4472:Lmbr1l UTSW 15 98906297 missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98912242 missense probably damaging 1.00
R5410:Lmbr1l UTSW 15 98909262 missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98904791 missense probably damaging 1.00
R5667:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5671:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98912427 missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98909240 missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98907586 missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98906323 missense probably benign 0.05
R7136:Lmbr1l UTSW 15 98911491 splice site probably null
R7169:Lmbr1l UTSW 15 98909158 frame shift probably null
R7169:Lmbr1l UTSW 15 98909194 critical splice donor site probably benign
R7336:Lmbr1l UTSW 15 98913587 missense possibly damaging 0.94
R7541:Lmbr1l UTSW 15 98909386 critical splice donor site probably null
R7603:Lmbr1l UTSW 15 98908691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCTGTACCTAACCGACTG -3'
(R):5'- GTACTGCAGCAGATTTGGGG -3'

Sequencing Primer
(F):5'- TGTACCTAACCGACTGAGTTATC -3'
(R):5'- GGGGGTGTTTGGAGAGAGAG -3'
Posted On2014-11-12