Incidental Mutation 'R2419:Olfr340'
ID249119
Institutional Source Beutler Lab
Gene Symbol Olfr340
Ensembl Gene ENSMUSG00000094266
Gene Nameolfactory receptor 340
SynonymsGA_x6K02T2NLDC-33147742-33148680, MOR136-1
MMRRC Submission 040381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2419 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36452587-36453525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36453326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 247 (V247E)
Ref Sequence ENSEMBL: ENSMUSP00000072632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072854]
Predicted Effect probably damaging
Transcript: ENSMUST00000072854
AA Change: V247E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072632
Gene: ENSMUSG00000094266
AA Change: V247E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.8e-6 PFAM
Pfam:7tm_1 41 290 1.4e-23 PFAM
Meta Mutation Damage Score 0.5767 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,974,146 T1160A possibly damaging Het
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acyp2 T C 11: 30,632,316 Y33C probably benign Het
Ampd3 A G 7: 110,768,369 probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Arl4d A T 11: 101,666,888 Q80L probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Ccdc38 T A 10: 93,548,975 V35D probably benign Het
Cd6 G A 19: 10,792,852 P492S probably damaging Het
Cdh20 G A 1: 104,975,015 S477N possibly damaging Het
Cnmd G A 14: 79,638,048 P311S probably damaging Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Dusp18 T C 11: 3,897,018 S3P possibly damaging Het
Eml2 A G 7: 19,176,695 probably benign Het
Foxb2 G C 19: 16,872,961 A227G probably damaging Het
Hey1 A G 3: 8,665,943 probably null Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kcna2 G A 3: 107,104,153 G17R probably benign Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Leng9 A G 7: 4,148,627 V350A probably benign Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Lrat A G 3: 82,903,685 S10P probably damaging Het
Lrrk2 C A 15: 91,797,526 probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Met T C 6: 17,535,830 probably benign Het
Mical3 A G 6: 120,959,923 V342A probably benign Het
Nup210 G A 6: 91,017,556 probably benign Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr1357 T A 10: 78,612,387 I85F probably benign Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Phc3 T C 3: 30,950,878 M189V probably damaging Het
Plcb1 A G 2: 135,262,100 probably benign Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Rbbp5 T C 1: 132,493,826 I88T possibly damaging Het
Rfpl4b T C 10: 38,821,372 R78G probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Sdad1 T C 5: 92,305,818 H37R possibly damaging Het
Setd2 T A 9: 110,548,997 F627I possibly damaging Het
Ski A G 4: 155,160,893 S293P probably benign Het
Slc27a1 A G 8: 71,579,916 E191G possibly damaging Het
Snx18 T C 13: 113,617,219 M393V possibly damaging Het
Tacc1 A G 8: 25,182,813 V42A possibly damaging Het
Tbc1d8 A G 1: 39,376,902 F897L probably damaging Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem62 G A 2: 121,007,105 G501E probably damaging Het
Tmem94 A G 11: 115,796,815 K1167E probably damaging Het
Trap1 A G 16: 4,068,330 S88P probably benign Het
Ugt2b38 T C 5: 87,423,732 D147G probably damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Zcchc14 T A 8: 121,603,936 Q896L probably damaging Het
Zfp619 A G 7: 39,535,883 K446E possibly damaging Het
Zpr1 T C 9: 46,276,192 probably benign Het
Other mutations in Olfr340
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Olfr340 APN 2 36452644 nonsense probably null
IGL01590:Olfr340 APN 2 36452992 missense probably benign 0.39
IGL01614:Olfr340 APN 2 36452624 missense probably benign 0.32
IGL02470:Olfr340 APN 2 36452597 missense probably benign 0.00
IGL02943:Olfr340 APN 2 36453039 missense probably benign 0.05
R0089:Olfr340 UTSW 2 36453095 missense probably benign 0.00
R0600:Olfr340 UTSW 2 36452648 missense probably benign 0.06
R0881:Olfr340 UTSW 2 36453440 missense probably damaging 1.00
R1945:Olfr340 UTSW 2 36453031 missense probably damaging 1.00
R2184:Olfr340 UTSW 2 36453034 missense probably benign
R2196:Olfr340 UTSW 2 36452588 start codon destroyed probably null 1.00
R2859:Olfr340 UTSW 2 36453130 missense probably benign 0.01
R2964:Olfr340 UTSW 2 36452767 missense probably damaging 1.00
R4677:Olfr340 UTSW 2 36453050 missense probably benign 0.00
R4867:Olfr340 UTSW 2 36453199 missense probably benign
R5468:Olfr340 UTSW 2 36453443 missense probably damaging 0.99
R5582:Olfr340 UTSW 2 36453221 missense probably benign 0.03
R6335:Olfr340 UTSW 2 36452722 missense probably benign 0.22
R6415:Olfr340 UTSW 2 36452605 missense probably damaging 0.99
R6664:Olfr340 UTSW 2 36453098 missense probably benign 0.00
R6873:Olfr340 UTSW 2 36453496 missense probably benign 0.00
R7097:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7122:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7199:Olfr340 UTSW 2 36452860 missense probably damaging 1.00
R7275:Olfr340 UTSW 2 36452839 missense probably benign 0.05
R7812:Olfr340 UTSW 2 36453278 missense probably benign 0.00
R8260:Olfr340 UTSW 2 36452885 missense probably damaging 1.00
Z1088:Olfr340 UTSW 2 36452906 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTACCTTGCTGAAGCTGTCCAG -3'
(R):5'- GCCCATCACTGTGACCAAAG -3'

Sequencing Primer
(F):5'- TGTCCAGCTCAGACACTACC -3'
(R):5'- AAAGTCTCCCGCTGAGGATATTTC -3'
Posted On2014-11-12