Incidental Mutation 'R2419:Lrat'
ID 249126
Institutional Source Beutler Lab
Gene Symbol Lrat
Ensembl Gene ENSMUSG00000028003
Gene Name lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms
MMRRC Submission 040381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R2419 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 82892579-82903973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82903685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 10 (S10P)
Ref Sequence ENSEMBL: ENSMUSP00000029632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029632]
AlphaFold Q9JI60
PDB Structure Crystal structure of HRASLS3/LRAT chimeric protein [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029632
AA Change: S10P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029632
Gene: ENSMUSG00000028003
AA Change: S10P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LRAT 43 174 1.4e-44 PFAM
low complexity region 194 205 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156457
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit retinol homeostasis abnormalities and are more susceptible to vitamin A deficiency or display impaired vision associated with abnormal retinol metabolism. Males have testicular hypoplasia/atrophy and reduced mature sperm counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,974,146 T1160A possibly damaging Het
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acyp2 T C 11: 30,632,316 Y33C probably benign Het
Ampd3 A G 7: 110,768,369 probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Arl4d A T 11: 101,666,888 Q80L probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Ccdc38 T A 10: 93,548,975 V35D probably benign Het
Cd6 G A 19: 10,792,852 P492S probably damaging Het
Cdh20 G A 1: 104,975,015 S477N possibly damaging Het
Cnmd G A 14: 79,638,048 P311S probably damaging Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Dusp18 T C 11: 3,897,018 S3P possibly damaging Het
Eml2 A G 7: 19,176,695 probably benign Het
Foxb2 G C 19: 16,872,961 A227G probably damaging Het
Hey1 A G 3: 8,665,943 probably null Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kcna2 G A 3: 107,104,153 G17R probably benign Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Leng9 A G 7: 4,148,627 V350A probably benign Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Lrrk2 C A 15: 91,797,526 probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Met T C 6: 17,535,830 probably benign Het
Mical3 A G 6: 120,959,923 V342A probably benign Het
Nup210 G A 6: 91,017,556 probably benign Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr1357 T A 10: 78,612,387 I85F probably benign Het
Olfr340 T A 2: 36,453,326 V247E probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Phc3 T C 3: 30,950,878 M189V probably damaging Het
Plcb1 A G 2: 135,262,100 probably benign Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Rbbp5 T C 1: 132,493,826 I88T possibly damaging Het
Rfpl4b T C 10: 38,821,372 R78G probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Sdad1 T C 5: 92,305,818 H37R possibly damaging Het
Setd2 T A 9: 110,548,997 F627I possibly damaging Het
Ski A G 4: 155,160,893 S293P probably benign Het
Slc27a1 A G 8: 71,579,916 E191G possibly damaging Het
Snx18 T C 13: 113,617,219 M393V possibly damaging Het
Tacc1 A G 8: 25,182,813 V42A possibly damaging Het
Tbc1d8 A G 1: 39,376,902 F897L probably damaging Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem62 G A 2: 121,007,105 G501E probably damaging Het
Tmem94 A G 11: 115,796,815 K1167E probably damaging Het
Trap1 A G 16: 4,068,330 S88P probably benign Het
Ugt2b38 T C 5: 87,423,732 D147G probably damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Zcchc14 T A 8: 121,603,936 Q896L probably damaging Het
Zfp619 A G 7: 39,535,883 K446E possibly damaging Het
Zpr1 T C 9: 46,276,192 probably benign Het
Other mutations in Lrat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Lrat APN 3 82903349 missense probably damaging 0.99
R1445:Lrat UTSW 3 82903369 missense probably damaging 1.00
R1491:Lrat UTSW 3 82903342 missense probably benign 0.07
R1735:Lrat UTSW 3 82897110 missense probably benign 0.01
R4446:Lrat UTSW 3 82896986 missense probably damaging 0.98
R5442:Lrat UTSW 3 82903220 missense probably damaging 1.00
R5495:Lrat UTSW 3 82896982 missense probably benign 0.00
R6255:Lrat UTSW 3 82903505 missense probably damaging 1.00
R6468:Lrat UTSW 3 82903492 missense probably damaging 1.00
R6909:Lrat UTSW 3 82903654 missense probably damaging 1.00
R7041:Lrat UTSW 3 82903448 missense probably benign 0.03
R7396:Lrat UTSW 3 82903283 nonsense probably null
R8369:Lrat UTSW 3 82903558 missense probably damaging 0.97
Z1177:Lrat UTSW 3 82903490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGGGCGACACGGTTTTC -3'
(R):5'- AGGCACACTACCTCTTCAGC -3'

Sequencing Primer
(F):5'- TCCCCCAGGTAGATCCCATAGTG -3'
(R):5'- GCTGAGCCAAGCACTTTG -3'
Posted On 2014-11-12