Incidental Mutation 'R2419:Met'
ID249133
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
MMRRC Submission 040381-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2419 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 17535830 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably benign
Transcript: ENSMUST00000080469
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115442
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115443
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145473
Predicted Effect probably benign
Transcript: ENSMUST00000152802
SMART Domains Protein: ENSMUSP00000118755
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
IPT 21 116 3.38e-16 SMART
IPT 118 202 4.34e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,974,146 T1160A possibly damaging Het
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acyp2 T C 11: 30,632,316 Y33C probably benign Het
Ampd3 A G 7: 110,768,369 probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Arl4d A T 11: 101,666,888 Q80L probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Ccdc38 T A 10: 93,548,975 V35D probably benign Het
Cd6 G A 19: 10,792,852 P492S probably damaging Het
Cdh20 G A 1: 104,975,015 S477N possibly damaging Het
Cnmd G A 14: 79,638,048 P311S probably damaging Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Dusp18 T C 11: 3,897,018 S3P possibly damaging Het
Eml2 A G 7: 19,176,695 probably benign Het
Foxb2 G C 19: 16,872,961 A227G probably damaging Het
Hey1 A G 3: 8,665,943 probably null Het
Itk A G 11: 46,338,217 F379L probably damaging Het
Kcna2 G A 3: 107,104,153 G17R probably benign Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Leng9 A G 7: 4,148,627 V350A probably benign Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Lrat A G 3: 82,903,685 S10P probably damaging Het
Lrrk2 C A 15: 91,797,526 probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Mical3 A G 6: 120,959,923 V342A probably benign Het
Nup210 G A 6: 91,017,556 probably benign Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr1357 T A 10: 78,612,387 I85F probably benign Het
Olfr340 T A 2: 36,453,326 V247E probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Phc3 T C 3: 30,950,878 M189V probably damaging Het
Plcb1 A G 2: 135,262,100 probably benign Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Rbbp5 T C 1: 132,493,826 I88T possibly damaging Het
Rfpl4b T C 10: 38,821,372 R78G probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Sdad1 T C 5: 92,305,818 H37R possibly damaging Het
Setd2 T A 9: 110,548,997 F627I possibly damaging Het
Ski A G 4: 155,160,893 S293P probably benign Het
Slc27a1 A G 8: 71,579,916 E191G possibly damaging Het
Snx18 T C 13: 113,617,219 M393V possibly damaging Het
Tacc1 A G 8: 25,182,813 V42A possibly damaging Het
Tbc1d8 A G 1: 39,376,902 F897L probably damaging Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem62 G A 2: 121,007,105 G501E probably damaging Het
Tmem94 A G 11: 115,796,815 K1167E probably damaging Het
Trap1 A G 16: 4,068,330 S88P probably benign Het
Ugt2b38 T C 5: 87,423,732 D147G probably damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Zcchc14 T A 8: 121,603,936 Q896L probably damaging Het
Zfp619 A G 7: 39,535,883 K446E possibly damaging Het
Zpr1 T C 9: 46,276,192 probably benign Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCTATCAGTCCACCAACAATAG -3'
(R):5'- AGCCAAAATGTCCTTGTGCC -3'

Sequencing Primer
(F):5'- CACATTTAGTCGGTAAAAATTCAGCC -3'
(R):5'- CTTGTGCCCTAAAAGCTTGGCAG -3'
Posted On2014-11-12