Incidental Mutation 'R2419:Itk'
ID249156
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene NameIL2 inducible T cell kinase
SynonymsEmt, Tsk, Tcsk
MMRRC Submission 040381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2419 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46325150-46389515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46338217 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 379 (F379L)
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000109237]
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000020664
AA Change: F373L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: F373L

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109237
AA Change: F379L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: F379L

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148132
Meta Mutation Damage Score 0.9285 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,974,146 T1160A possibly damaging Het
Abca2 G A 2: 25,437,989 A768T probably benign Het
Acyp2 T C 11: 30,632,316 Y33C probably benign Het
Ampd3 A G 7: 110,768,369 probably benign Het
Arap3 T C 18: 37,989,944 D501G probably damaging Het
Arl4d A T 11: 101,666,888 Q80L probably damaging Het
Bcorl1 A G X: 48,370,541 T425A probably damaging Het
Ccdc38 T A 10: 93,548,975 V35D probably benign Het
Cd6 G A 19: 10,792,852 P492S probably damaging Het
Cdh20 G A 1: 104,975,015 S477N possibly damaging Het
Cnmd G A 14: 79,638,048 P311S probably damaging Het
Cnot8 G A 11: 58,115,310 G222R probably damaging Het
Dnah9 A T 11: 66,095,415 L1131* probably null Het
Dscc1 G A 15: 55,083,424 R302* probably null Het
Dusp18 T C 11: 3,897,018 S3P possibly damaging Het
Eml2 A G 7: 19,176,695 probably benign Het
Foxb2 G C 19: 16,872,961 A227G probably damaging Het
Hey1 A G 3: 8,665,943 probably null Het
Kcna2 G A 3: 107,104,153 G17R probably benign Het
Kif7 C A 7: 79,698,693 R1300L probably benign Het
Klkb1 A T 8: 45,289,112 D43E possibly damaging Het
Leng9 A G 7: 4,148,627 V350A probably benign Het
Lmbr1l A C 15: 98,907,537 F361C possibly damaging Het
Lrat A G 3: 82,903,685 S10P probably damaging Het
Lrrk2 C A 15: 91,797,526 probably benign Het
Mcur1 C T 13: 43,549,537 V241M possibly damaging Het
Met T C 6: 17,535,830 probably benign Het
Mical3 A G 6: 120,959,923 V342A probably benign Het
Nup210 G A 6: 91,017,556 probably benign Het
Olfr1212 A G 2: 88,959,036 N190S probably benign Het
Olfr1357 T A 10: 78,612,387 I85F probably benign Het
Olfr340 T A 2: 36,453,326 V247E probably damaging Het
Pcdhac1 T C 18: 37,091,328 L398P probably benign Het
Phc3 T C 3: 30,950,878 M189V probably damaging Het
Plcb1 A G 2: 135,262,100 probably benign Het
Plcxd3 G T 15: 4,574,763 K284N probably benign Het
Plxnb2 A G 15: 89,161,069 V1058A possibly damaging Het
Rbbp5 T C 1: 132,493,826 I88T possibly damaging Het
Rfpl4b T C 10: 38,821,372 R78G probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Samt2 A T X: 154,575,227 probably null Het
Sdad1 T C 5: 92,305,818 H37R possibly damaging Het
Setd2 T A 9: 110,548,997 F627I possibly damaging Het
Ski A G 4: 155,160,893 S293P probably benign Het
Slc27a1 A G 8: 71,579,916 E191G possibly damaging Het
Snx18 T C 13: 113,617,219 M393V possibly damaging Het
Tacc1 A G 8: 25,182,813 V42A possibly damaging Het
Tbc1d8 A G 1: 39,376,902 F897L probably damaging Het
Tenm3 C T 8: 48,276,658 D1438N possibly damaging Het
Tmem62 G A 2: 121,007,105 G501E probably damaging Het
Tmem94 A G 11: 115,796,815 K1167E probably damaging Het
Trap1 A G 16: 4,068,330 S88P probably benign Het
Ugt2b38 T C 5: 87,423,732 D147G probably damaging Het
Vmn1r168 A T 7: 23,541,399 N227I probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn1r204 T G 13: 22,556,250 L17R probably damaging Het
Zcchc14 T A 8: 121,603,936 Q896L probably damaging Het
Zfp619 A G 7: 39,535,883 K446E possibly damaging Het
Zpr1 T C 9: 46,276,192 probably benign Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8188:Itk UTSW 11 46331949 nonsense probably null
R8337:Itk UTSW 11 46342395 splice site probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTACAAGCACAGCCGGGAC -3'
(R):5'- ACCCTGTAACAATCCTCTTGG -3'

Sequencing Primer
(F):5'- GGACCCTCCTTCCCAGCATG -3'
(R):5'- TAGTAACTACCTATGACACTCTAAGC -3'
Posted On2014-11-12