Incidental Mutation 'R2420:Fga'
ID249190
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R2420 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83033154 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 705 (N705I)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably benign
Transcript: ENSMUST00000029630
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166581
AA Change: N705I

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: N705I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
6820408C15Rik A G 2: 152,429,001 K48R probably damaging Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Chst9 A T 18: 15,452,284 N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt10 G A 11: 99,387,107 T338I possibly damaging Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Shank3 A T 15: 89,521,210 K455* probably null Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTGGCTAGGCAATGACTACCTC -3'
(R):5'- CCCGTTCTCTATCTCATAGGGG -3'

Sequencing Primer
(F):5'- CTCAGTTCTCAGGGTTGAATTAGAG -3'
(R):5'- CTATCTCATAGGGGCTGTTGTTCC -3'
Posted On2014-11-12