Mutagenetix > Incidental Mutation

Incidental Mutation 'R2420:Adamts3'

249195

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

040382-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2420 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89683175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1007 (S1007P)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061427
AA Change: S1006P

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: S1006P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122551

Predicted Effect

probably damaging
Transcript: ENSMUST00000163159
AA Change: S1007P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: S1007P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Meta Mutation Damage Score

0.2151

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	C	5: 5,455,912	Y123C	probably benign	Het
6820408C15Rik	A	G	2: 152,429,001	K48R	probably damaging	Het
Acsm2	T	C	7: 119,563,634	F44L	probably damaging	Het
Actr5	T	C	2: 158,636,081	F457S	probably damaging	Het
Ahnak	C	T	19: 9,009,256	P2635S	possibly damaging	Het
Ankrd17	A	T	5: 90,289,320	D555E	possibly damaging	Het
Arhgap29	A	G	3: 121,973,980	I24V	probably benign	Het
Atxn2	A	T	5: 121,802,079		probably null	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Ccdc137	G	A	11: 120,462,264		probably null	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Chst9	A	T	18: 15,452,284	N407K	probably damaging	Het
Cwf19l2	A	G	9: 3,411,341	K73E	possibly damaging	Het
Dhcr24	G	T	4: 106,561,094		probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Egln1	T	C	8: 124,948,246	N270S	probably benign	Het
Eme1	A	G	11: 94,645,814		probably null	Het
Emilin2	A	G	17: 71,274,279	I484T	possibly damaging	Het
Entpd2	T	C	2: 25,399,283	I259T	probably benign	Het
Fbp1	T	C	13: 62,871,306	K24E	probably benign	Het
Fga	A	T	3: 83,033,154	N705I	possibly damaging	Het
Gas1	G	T	13: 60,176,930		probably benign	Het
Glrb	A	G	3: 80,860,235	I226T	probably damaging	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm44501	A	T	17: 40,578,709	H38L	possibly damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Jcad	T	C	18: 4,675,952	M1238T	probably damaging	Het
Kank1	T	C	19: 25,410,457	L498S	probably damaging	Het
Krt10	G	A	11: 99,387,107	T338I	possibly damaging	Het
Krt13	A	T	11: 100,120,051	L159Q	probably benign	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lilra6	A	G	7: 3,914,858	Y96H	probably damaging	Het
Ltc4s	A	G	11: 50,237,339		probably null	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Mfn1	A	G	3: 32,569,515	I263V	probably benign	Het
Mmaa	T	A	8: 79,281,432	R59W	probably damaging	Het
Mug2	C	A	6: 122,083,460	T1385K	probably damaging	Het
Mypn	G	T	10: 63,192,869	Y138*	probably null	Het
Nav3	A	C	10: 109,863,813	S273R	probably damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Olfr1219	T	C	2: 89,074,992	Y33C	possibly damaging	Het
Olfr1290	T	C	2: 111,489,257		probably null	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr470	T	C	7: 107,844,818	K305R	probably benign	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pak1	A	T	7: 97,854,479	D7V	probably benign	Het
Pax3	A	T	1: 78,196,864		probably null	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Prickle1	A	G	15: 93,503,637	F322S	probably damaging	Het
Prl8a2	A	G	13: 27,348,913	E36G	possibly damaging	Het
Prss45	A	G	9: 110,839,092	I118V	possibly damaging	Het
Psd4	T	G	2: 24,401,241	V597G	probably damaging	Het
Psmb10	A	G	8: 105,937,302	S108P	probably benign	Het
Shank3	A	T	15: 89,521,210	K455*	probably null	Het
Spag17	T	A	3: 100,027,619	W714R	probably benign	Het
Synrg	A	G	11: 84,009,224	E674G	probably damaging	Het
Tep1	T	A	14: 50,834,023	H2055L	probably benign	Het
Terb1	T	C	8: 104,498,595	T14A	probably damaging	Het
Tmub2	T	A	11: 102,287,755	D161E	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyr	T	A	7: 87,429,189	I488F	probably benign	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Wnk1	A	G	6: 119,936,367		probably null	Het
Zfhx4	C	A	3: 5,390,405	A1153E	probably benign	Het
Zfp13	A	C	17: 23,576,212	Y462D	probably damaging	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- GATGCTGGCCCTATTTCAAACAG -3'
(R):5'- ACTCCAGAGTTGTCAAGTGG -3'

Sequencing Primer
(F):5'- GGCCCTATTTCAAACAGCATTCTCAG -3'
(R):5'- CCAGAGTTGTCAAGTGGTTTGTGAC -3'

Posted On

2014-11-12