Incidental Mutation 'R2420:Ccdc18'
ID 249198
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 1700021E15Rik, 4932411G06Rik
MMRRC Submission 040382-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2420 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 108280741-108381494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 108376454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1298 (E1298D)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
AlphaFold Q640L5
Predicted Effect probably damaging
Transcript: ENSMUST00000047677
AA Change: E1298D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: E1298D

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Meta Mutation Damage Score 0.0809 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,270,921 (GRCm39) K48R probably damaging Het
Acsm2 T C 7: 119,162,857 (GRCm39) F44L probably damaging Het
Actr5 T C 2: 158,478,001 (GRCm39) F457S probably damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Ahnak C T 19: 8,986,620 (GRCm39) P2635S possibly damaging Het
Ankrd17 A T 5: 90,437,179 (GRCm39) D555E possibly damaging Het
Arhgap29 A G 3: 121,767,629 (GRCm39) I24V probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Chst9 A T 18: 15,585,341 (GRCm39) N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 (GRCm39) K73E possibly damaging Het
Dhcr24 G T 4: 106,418,291 (GRCm39) probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Egln1 T C 8: 125,674,985 (GRCm39) N270S probably benign Het
Eme1 A G 11: 94,536,640 (GRCm39) probably null Het
Emilin2 A G 17: 71,581,274 (GRCm39) I484T possibly damaging Het
Entpd2 T C 2: 25,289,295 (GRCm39) I259T probably benign Het
Fbp1 T C 13: 63,019,120 (GRCm39) K24E probably benign Het
Fga A T 3: 82,940,461 (GRCm39) N705I possibly damaging Het
Gas1 G T 13: 60,324,744 (GRCm39) probably benign Het
Glrb A G 3: 80,767,542 (GRCm39) I226T probably damaging Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm44501 A T 17: 40,889,600 (GRCm39) H38L possibly damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Jcad T C 18: 4,675,952 (GRCm39) M1238T probably damaging Het
Kank1 T C 19: 25,387,821 (GRCm39) L498S probably damaging Het
Krt10 G A 11: 99,277,933 (GRCm39) T338I possibly damaging Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lilra6 A G 7: 3,917,857 (GRCm39) Y96H probably damaging Het
Ltc4s A G 11: 50,128,166 (GRCm39) probably null Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Mfn1 A G 3: 32,623,664 (GRCm39) I263V probably benign Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Mug2 C A 6: 122,060,419 (GRCm39) T1385K probably damaging Het
Mypn G T 10: 63,028,648 (GRCm39) Y138* probably null Het
Nav3 A C 10: 109,699,674 (GRCm39) S273R probably damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or4k42 T C 2: 111,319,602 (GRCm39) probably null Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5p51 T C 7: 107,444,025 (GRCm39) K305R probably benign Het
Pak1 A T 7: 97,503,686 (GRCm39) D7V probably benign Het
Pax3 A T 1: 78,173,501 (GRCm39) probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Prickle1 A G 15: 93,401,518 (GRCm39) F322S probably damaging Het
Prl8a2 A G 13: 27,532,896 (GRCm39) E36G possibly damaging Het
Prss45 A G 9: 110,668,160 (GRCm39) I118V possibly damaging Het
Psd4 T G 2: 24,291,253 (GRCm39) V597G probably damaging Het
Psmb10 A G 8: 106,663,934 (GRCm39) S108P probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Shank3 A T 15: 89,405,413 (GRCm39) K455* probably null Het
Spag17 T A 3: 99,934,935 (GRCm39) W714R probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Tep1 T A 14: 51,071,480 (GRCm39) H2055L probably benign Het
Terb1 T C 8: 105,225,227 (GRCm39) T14A probably damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyr T A 7: 87,078,397 (GRCm39) I488F probably benign Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Wnk1 A G 6: 119,913,328 (GRCm39) probably null Het
Zfhx4 C A 3: 5,455,465 (GRCm39) A1153E probably benign Het
Zfp13 A C 17: 23,795,186 (GRCm39) Y462D probably damaging Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108,328,391 (GRCm39) missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108,328,753 (GRCm39) missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108,350,052 (GRCm39) splice site probably benign
IGL01718:Ccdc18 APN 5 108,349,214 (GRCm39) missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108,349,977 (GRCm39) missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108,296,788 (GRCm39) missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108,283,918 (GRCm39) missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108,319,614 (GRCm39) missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108,283,835 (GRCm39) splice site probably benign
IGL02880:Ccdc18 APN 5 108,283,310 (GRCm39) missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108,376,767 (GRCm39) missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108,359,997 (GRCm39) missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108,306,485 (GRCm39) missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108,309,566 (GRCm39) missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108,321,627 (GRCm39) missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108,321,655 (GRCm39) missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108,322,830 (GRCm39) missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108,328,282 (GRCm39) missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108,322,853 (GRCm39) missense probably damaging 1.00
R0648:Ccdc18 UTSW 5 108,283,426 (GRCm39) missense probably damaging 0.99
R0666:Ccdc18 UTSW 5 108,311,530 (GRCm39) missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108,349,982 (GRCm39) nonsense probably null
R1509:Ccdc18 UTSW 5 108,336,844 (GRCm39) missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108,339,843 (GRCm39) missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108,360,054 (GRCm39) missense probably benign
R1663:Ccdc18 UTSW 5 108,363,956 (GRCm39) missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108,341,668 (GRCm39) missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108,368,703 (GRCm39) missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108,343,908 (GRCm39) missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108,376,861 (GRCm39) missense probably damaging 1.00
R2421:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4079:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4244:Ccdc18 UTSW 5 108,296,838 (GRCm39) nonsense probably null
R4409:Ccdc18 UTSW 5 108,368,708 (GRCm39) nonsense probably null
R4428:Ccdc18 UTSW 5 108,283,943 (GRCm39) missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108,309,395 (GRCm39) missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108,376,826 (GRCm39) missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108,283,307 (GRCm39) missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108,284,007 (GRCm39) missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108,339,869 (GRCm39) missense probably benign
R5039:Ccdc18 UTSW 5 108,306,514 (GRCm39) critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108,288,740 (GRCm39) missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108,354,594 (GRCm39) missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108,311,625 (GRCm39) missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108,319,484 (GRCm39) missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108,322,753 (GRCm39) missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108,309,448 (GRCm39) missense probably benign
R6359:Ccdc18 UTSW 5 108,283,391 (GRCm39) missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108,322,820 (GRCm39) missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108,349,214 (GRCm39) missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108,309,612 (GRCm39) missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108,339,790 (GRCm39) missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108,286,796 (GRCm39) missense probably benign
R6664:Ccdc18 UTSW 5 108,315,966 (GRCm39) nonsense probably null
R6836:Ccdc18 UTSW 5 108,345,833 (GRCm39) missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108,309,401 (GRCm39) missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108,321,728 (GRCm39) critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108,309,554 (GRCm39) missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108,341,664 (GRCm39) missense probably benign
R7087:Ccdc18 UTSW 5 108,343,988 (GRCm39) missense probably benign
R7117:Ccdc18 UTSW 5 108,296,835 (GRCm39) missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108,315,972 (GRCm39) missense probably benign
R7382:Ccdc18 UTSW 5 108,286,873 (GRCm39) missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108,368,716 (GRCm39) missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108,354,483 (GRCm39) nonsense probably null
R7506:Ccdc18 UTSW 5 108,311,605 (GRCm39) missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108,376,915 (GRCm39) critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108,376,528 (GRCm39) missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108,296,907 (GRCm39) critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108,328,699 (GRCm39) missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8019:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8172:Ccdc18 UTSW 5 108,311,640 (GRCm39) critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108,345,661 (GRCm39) missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108,309,369 (GRCm39) missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108,363,899 (GRCm39) missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108,345,725 (GRCm39) missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108,328,283 (GRCm39) missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108,296,856 (GRCm39) missense probably damaging 0.98
R9391:Ccdc18 UTSW 5 108,376,770 (GRCm39) missense probably benign 0.02
R9418:Ccdc18 UTSW 5 108,303,669 (GRCm39) missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108,286,792 (GRCm39) missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108,339,800 (GRCm39) missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108,368,582 (GRCm39) missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108,339,788 (GRCm39) missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108,360,063 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGGTTTGAACAACACTTGC -3'
(R):5'- GGCACTAATAGACCGACGTAG -3'

Sequencing Primer
(F):5'- AATTTCTGAGTTCGAGGCCAGC -3'
(R):5'- CGTAGTTTTCTGCATTTGAAAAGTG -3'
Posted On 2014-11-12