Mutagenetix > Incidental Mutations

Incidental Mutation 'R0305:Adam21'

24921

Institutional Source

Beutler Lab

Gene Symbol

Adam21

Ensembl Gene

ENSMUSG00000008438

Gene Name

a disintegrin and metallopeptidase domain 21

Synonyms

ADAM31

MMRRC Submission

038516-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81558584-81568474 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81560285 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 234 (K234N)

Ref Sequence

ENSEMBL: ENSMUSP00000008582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008582]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000008582
AA Change: K234N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000008582
Gene: ENSMUSG00000008438
AA Change: K234N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	164	5.1e-21	PFAM
Pfam:Reprolysin_4	212	389	2.5e-11	PFAM
Pfam:Reprolysin	212	402	7.3e-50	PFAM
Pfam:Reprolysin_5	214	400	5.8e-19	PFAM
Pfam:Reprolysin_2	233	393	1.3e-14	PFAM
Pfam:Reprolysin_3	236	356	6.5e-16	PFAM
DISIN	419	494	2.45e-37	SMART
ACR	495	631	6.49e-62	SMART
EGF	637	667	2.03e1	SMART
transmembrane domain	687	709	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166971

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. The encoded protein functions in the regulation of spermatogenesis in the testes and neurogenesis in the central nervous system. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	G	A	7: 27,574,636	R183Q	probably damaging	Het
Abca5	A	G	11: 110,273,311		probably benign	Het
Ada	T	C	2: 163,728,157	K312R	probably benign	Het
Afdn	T	A	17: 13,888,514		probably null	Het
Aimp1	T	G	3: 132,673,986	K132Q	possibly damaging	Het
Aldh16a1	C	T	7: 45,147,979	R135Q	probably damaging	Het
Alox12b	A	T	11: 69,167,379	Y519F	probably benign	Het
Alppl2	T	C	1: 87,089,602	E25G	probably benign	Het
Apob	A	T	12: 8,012,210	N3531I	probably damaging	Het
Arhgap23	T	C	11: 97,501,109	L321P	probably damaging	Het
Cab39l	C	T	14: 59,519,579	Q137*	probably null	Het
Cenpo	A	T	12: 4,216,660	H149Q	possibly damaging	Het
Cpt1a	A	G	19: 3,378,455	T610A	probably benign	Het
Dcbld2	A	G	16: 58,448,939	T271A	probably damaging	Het
Dcps	A	G	9: 35,175,769		probably null	Het
Dnaic2	A	G	11: 114,752,894	D462G	probably benign	Het
Dsg2	T	A	18: 20,582,695		probably benign	Het
Eomes	A	T	9: 118,484,757	E623D	probably benign	Het
Fam19a5	T	A	15: 87,720,508	I83N	probably damaging	Het
Fras1	A	T	5: 96,596,888	H594L	probably benign	Het
Gad1-ps	T	G	10: 99,444,803		noncoding transcript	Het
Galk2	A	G	2: 125,887,888	Y63C	probably damaging	Het
H2-T10	A	G	17: 36,119,368	L227P	probably damaging	Het
Itgb4	T	G	11: 115,979,412	C73G	probably damaging	Het
Itpr2	T	C	6: 146,311,103	H1472R	possibly damaging	Het
Kcnh5	C	T	12: 75,114,397	A246T	probably benign	Het
Kpna6	G	T	4: 129,649,249	R458S	probably benign	Het
Lifr	A	G	15: 7,177,501	T498A	probably damaging	Het
Lrrd1	T	G	5: 3,865,707	I768S	probably damaging	Het
Map2	T	C	1: 66,413,094	V223A	probably benign	Het
Nod2	G	A	8: 88,665,323	A731T	probably damaging	Het
Nrxn2	G	A	19: 6,519,283	C1403Y	probably damaging	Het
Nxph1	A	T	6: 9,247,754	I242F	probably damaging	Het
Olfr507	G	A	7: 108,622,585	V258I	probably benign	Het
Pgr	A	G	9: 8,902,087		probably benign	Het
Pik3cb	A	G	9: 99,064,076	S566P	possibly damaging	Het
Sema4d	T	C	13: 51,712,728	Y242C	probably damaging	Het
Sftpc	T	A	14: 70,524,078		probably benign	Het
Sh3tc1	T	G	5: 35,723,999	E33D	probably benign	Het
Slc17a5	A	G	9: 78,557,537	L344P	probably benign	Het
Slc39a5	T	A	10: 128,398,396		probably benign	Het
Slc7a13	C	A	4: 19,839,401	H335N	probably benign	Het
Slco1a4	A	C	6: 141,817,753	N412K	possibly damaging	Het
Sox1	A	T	8: 12,396,736	T126S	probably damaging	Het
Specc1l	T	A	10: 75,245,829	V353E	probably damaging	Het
Stat5b	T	C	11: 100,802,503	E104G	probably benign	Het
Sult4a1	A	G	15: 84,086,667	V179A	probably damaging	Het
Tbl3	G	A	17: 24,705,461	R134C	probably damaging	Het
Tmem256	T	A	11: 69,838,911		probably benign	Het
Tmigd1	A	G	11: 76,907,134	T101A	probably damaging	Het
Unc5b	C	A	10: 60,779,658		probably benign	Het
Unc79	T	A	12: 103,113,200	S1679T	probably benign	Het
Vmn2r1	T	G	3: 64,089,666	C248G	probably damaging	Het
Vmn2r57	T	C	7: 41,427,543	I400V	probably benign	Het
Vwa8	T	A	14: 79,009,273	L685H	probably damaging	Het
Yeats4	A	G	10: 117,215,836	F172S	probably damaging	Het
Zfpm2	T	G	15: 40,774,035		probably benign	Het

Other mutations in Adam21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02186:Adam21	APN	12	81559209	missense	possibly damaging	0.61
IGL02311:Adam21	APN	12	81560892	missense	probably benign	0.01
IGL03132:Adam21	APN	12	81560374	nonsense	probably null
IGL03225:Adam21	APN	12	81559269	missense	probably benign	0.00
R0634:Adam21	UTSW	12	81560352	missense	probably benign	0.01
R1415:Adam21	UTSW	12	81559547	nonsense	probably null
R1961:Adam21	UTSW	12	81559508	nonsense	probably null
R1996:Adam21	UTSW	12	81559602	missense	possibly damaging	0.79
R2159:Adam21	UTSW	12	81560467	missense	probably benign	0.17
R2215:Adam21	UTSW	12	81560290	missense	probably damaging	1.00
R3780:Adam21	UTSW	12	81559273	missense	probably damaging	1.00
R3964:Adam21	UTSW	12	81560809	missense	possibly damaging	0.46
R4356:Adam21	UTSW	12	81558820	missense	probably damaging	0.99
R4503:Adam21	UTSW	12	81560898	missense	probably benign
R4795:Adam21	UTSW	12	81560974	missense	probably benign	0.06
R4925:Adam21	UTSW	12	81560389	missense	probably benign
R4932:Adam21	UTSW	12	81558918	missense	probably benign	0.14
R5110:Adam21	UTSW	12	81560215	missense	probably benign	0.40
R5831:Adam21	UTSW	12	81559101	missense	probably benign	0.06
R6289:Adam21	UTSW	12	81560706	missense	probably damaging	1.00
R6500:Adam21	UTSW	12	81559606	missense	probably benign	0.01
R7077:Adam21	UTSW	12	81559119	missense	probably damaging	1.00
R7083:Adam21	UTSW	12	81560241	missense	possibly damaging	0.81
R7173:Adam21	UTSW	12	81559234	missense	probably benign	0.24
R7176:Adam21	UTSW	12	81560248	missense	possibly damaging	0.94
R7232:Adam21	UTSW	12	81560556	missense	probably damaging	0.99
R7371:Adam21	UTSW	12	81560290	missense	probably damaging	1.00
R7486:Adam21	UTSW	12	81558883	missense	probably benign	0.00
R7522:Adam21	UTSW	12	81558948	missense	possibly damaging	0.78
Z1088:Adam21	UTSW	12	81560686	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGAGGAGGACGACATATTCCTGC -3'
(R):5'- TCAAGCACTCTAGCACATTCGAGC -3'

Sequencing Primer
(F):5'- CGACATATTCCTGCAATGTAGGC -3'
(R):5'- GACACAATTTCCACCTATGCTATG -3'

Posted On

2013-04-16