Incidental Mutation 'R0305:Adam21'
ID24921
Institutional Source Beutler Lab
Gene Symbol Adam21
Ensembl Gene ENSMUSG00000008438
Gene Namea disintegrin and metallopeptidase domain 21
SynonymsADAM31
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81558584-81568474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81560285 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 234 (K234N)
Ref Sequence ENSEMBL: ENSMUSP00000008582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008582
AA Change: K234N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000008582
Gene: ENSMUSG00000008438
AA Change: K234N

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 164 5.1e-21 PFAM
Pfam:Reprolysin_4 212 389 2.5e-11 PFAM
Pfam:Reprolysin 212 402 7.3e-50 PFAM
Pfam:Reprolysin_5 214 400 5.8e-19 PFAM
Pfam:Reprolysin_2 233 393 1.3e-14 PFAM
Pfam:Reprolysin_3 236 356 6.5e-16 PFAM
DISIN 419 494 2.45e-37 SMART
ACR 495 631 6.49e-62 SMART
EGF 637 667 2.03e1 SMART
transmembrane domain 687 709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166971
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. The encoded protein functions in the regulation of spermatogenesis in the testes and neurogenesis in the central nervous system. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Adam21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Adam21 APN 12 81559209 missense possibly damaging 0.61
IGL02311:Adam21 APN 12 81560892 missense probably benign 0.01
IGL03132:Adam21 APN 12 81560374 nonsense probably null
IGL03225:Adam21 APN 12 81559269 missense probably benign 0.00
R0634:Adam21 UTSW 12 81560352 missense probably benign 0.01
R1415:Adam21 UTSW 12 81559547 nonsense probably null
R1961:Adam21 UTSW 12 81559508 nonsense probably null
R1996:Adam21 UTSW 12 81559602 missense possibly damaging 0.79
R2159:Adam21 UTSW 12 81560467 missense probably benign 0.17
R2215:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R3780:Adam21 UTSW 12 81559273 missense probably damaging 1.00
R3964:Adam21 UTSW 12 81560809 missense possibly damaging 0.46
R4356:Adam21 UTSW 12 81558820 missense probably damaging 0.99
R4503:Adam21 UTSW 12 81560898 missense probably benign
R4795:Adam21 UTSW 12 81560974 missense probably benign 0.06
R4925:Adam21 UTSW 12 81560389 missense probably benign
R4932:Adam21 UTSW 12 81558918 missense probably benign 0.14
R5110:Adam21 UTSW 12 81560215 missense probably benign 0.40
R5831:Adam21 UTSW 12 81559101 missense probably benign 0.06
R6289:Adam21 UTSW 12 81560706 missense probably damaging 1.00
R6500:Adam21 UTSW 12 81559606 missense probably benign 0.01
R7077:Adam21 UTSW 12 81559119 missense probably damaging 1.00
R7083:Adam21 UTSW 12 81560241 missense possibly damaging 0.81
R7173:Adam21 UTSW 12 81559234 missense probably benign 0.24
R7176:Adam21 UTSW 12 81560248 missense possibly damaging 0.94
R7232:Adam21 UTSW 12 81560556 missense probably damaging 0.99
R7371:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R7486:Adam21 UTSW 12 81558883 missense probably benign 0.00
R7522:Adam21 UTSW 12 81558948 missense possibly damaging 0.78
Z1088:Adam21 UTSW 12 81560686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGAGGACGACATATTCCTGC -3'
(R):5'- TCAAGCACTCTAGCACATTCGAGC -3'

Sequencing Primer
(F):5'- CGACATATTCCTGCAATGTAGGC -3'
(R):5'- GACACAATTTCCACCTATGCTATG -3'
Posted On2013-04-16