Incidental Mutation 'R2420:Olfr975'
ID249214
Institutional Source Beutler Lab
Gene Symbol Olfr975
Ensembl Gene ENSMUSG00000043331
Gene Nameolfactory receptor 975
SynonymsMOR224-2, GA_x6K02T2PVTD-33651220-33650288
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2420 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39948131-39952046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39950528 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 81 (L81P)
Ref Sequence ENSEMBL: ENSMUSP00000150664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000216647] [ENSMUST00000217630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054067
AA Change: L81P

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: L81P

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect possibly damaging
Transcript: ENSMUST00000216647
AA Change: L81P

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
6820408C15Rik A G 2: 152,429,001 K48R probably damaging Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Chst9 A T 18: 15,452,284 N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Fga A T 3: 83,033,154 N705I possibly damaging Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt10 G A 11: 99,387,107 T338I possibly damaging Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Shank3 A T 15: 89,521,210 K455* probably null Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in Olfr975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Olfr975 APN 9 39949988 missense probably benign 0.01
IGL01537:Olfr975 APN 9 39950625 missense probably benign 0.00
IGL01963:Olfr975 APN 9 39950240 missense probably damaging 1.00
IGL02400:Olfr975 APN 9 39950339 missense probably benign
IGL03115:Olfr975 APN 9 39950744 missense probably damaging 0.98
IGL03226:Olfr975 APN 9 39950423 splice site probably null
R0088:Olfr975 UTSW 9 39950375 missense probably benign 0.03
R0212:Olfr975 UTSW 9 39949940 missense probably benign 0.44
R1668:Olfr975 UTSW 9 39950169 missense possibly damaging 0.94
R1878:Olfr975 UTSW 9 39950757 missense probably benign 0.35
R2225:Olfr975 UTSW 9 39950537 missense possibly damaging 0.84
R2291:Olfr975 UTSW 9 39950334 missense probably benign 0.19
R2421:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2422:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2425:Olfr975 UTSW 9 39949841 missense probably null 0.25
R2918:Olfr975 UTSW 9 39950364 missense probably benign
R4536:Olfr975 UTSW 9 39950435 missense probably damaging 1.00
R4709:Olfr975 UTSW 9 39949869 missense probably damaging 0.97
R4831:Olfr975 UTSW 9 39950112 missense probably benign 0.01
R4921:Olfr975 UTSW 9 39950225 missense probably damaging 0.98
R5113:Olfr975 UTSW 9 39949925 missense probably damaging 0.99
R5141:Olfr975 UTSW 9 39949874 missense probably benign 0.07
R5195:Olfr975 UTSW 9 39950679 missense probably benign
R5213:Olfr975 UTSW 9 39950093 missense probably damaging 0.99
R5568:Olfr975 UTSW 9 39950687 missense probably benign 0.05
R6993:Olfr975 UTSW 9 39950637 missense probably benign
R7080:Olfr975 UTSW 9 39950148 missense probably damaging 1.00
R7436:Olfr975 UTSW 9 39950053 nonsense probably null
R8178:Olfr975 UTSW 9 39950412 missense probably benign 0.05
R8179:Olfr975 UTSW 9 39950412 missense probably benign 0.05
R8382:Olfr975 UTSW 9 39950159 missense probably benign 0.21
R8402:Olfr975 UTSW 9 39950417 missense probably benign 0.39
R8511:Olfr975 UTSW 9 39950159 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGTCCACAGTAGGGTAACTTG -3'
(R):5'- TGGAAAGGATGCTCTTTGTCC -3'

Sequencing Primer
(F):5'- AGATGCGTGCAGACAGCTC -3'
(R):5'- AAAGGATGCTCTTTGTCCTCTTTTTG -3'
Posted On2014-11-12