Incidental Mutation 'R2420:Krt10'
ID249224
Institutional Source Beutler Lab
Gene Symbol Krt10
Ensembl Gene ENSMUSG00000019761
Gene Namekeratin 10
SynonymsKrt1-10, suprabasal cytokeratin 10, K10, Krt-1.10, keratin 10, D130054E02Rik, cytokeratin 10, K1C1
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R2420 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99385254-99389364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99387107 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 338 (T338I)
Ref Sequence ENSEMBL: ENSMUSP00000099420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103131] [ENSMUST00000211768]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103131
AA Change: T338I

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099420
Gene: ENSMUSG00000019761
AA Change: T338I

DomainStartEndE-ValueType
low complexity region 2 133 N/A INTRINSIC
Filament 134 448 6e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153599
Predicted Effect probably benign
Transcript: ENSMUST00000211768
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations may result in hyperkeratosis and blistering of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
6820408C15Rik A G 2: 152,429,001 K48R probably damaging Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Chst9 A T 18: 15,452,284 N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Fga A T 3: 83,033,154 N705I possibly damaging Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Shank3 A T 15: 89,521,210 K455* probably null Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in Krt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Krt10 APN 11 99389218 unclassified probably benign
Rough-fur UTSW 11 99388818 missense probably damaging 0.99
FR4304:Krt10 UTSW 11 99386199 unclassified probably benign
FR4304:Krt10 UTSW 11 99389274 unclassified probably benign
FR4340:Krt10 UTSW 11 99386202 unclassified probably benign
FR4340:Krt10 UTSW 11 99386203 unclassified probably benign
FR4340:Krt10 UTSW 11 99389274 unclassified probably benign
FR4342:Krt10 UTSW 11 99386199 unclassified probably benign
FR4342:Krt10 UTSW 11 99386203 unclassified probably benign
FR4449:Krt10 UTSW 11 99389267 unclassified probably benign
FR4548:Krt10 UTSW 11 99389273 unclassified probably benign
FR4548:Krt10 UTSW 11 99389276 unclassified probably benign
FR4589:Krt10 UTSW 11 99389276 unclassified probably benign
FR4737:Krt10 UTSW 11 99386197 unclassified probably benign
FR4737:Krt10 UTSW 11 99389273 unclassified probably benign
FR4737:Krt10 UTSW 11 99389279 unclassified probably benign
R1386:Krt10 UTSW 11 99385920 splice site probably benign
R1553:Krt10 UTSW 11 99385980 nonsense probably null
R1737:Krt10 UTSW 11 99387387 missense possibly damaging 0.81
R2082:Krt10 UTSW 11 99388875 missense probably damaging 1.00
R3409:Krt10 UTSW 11 99387261 missense probably damaging 1.00
R4027:Krt10 UTSW 11 99386193 unclassified probably benign
R4042:Krt10 UTSW 11 99386993 splice site probably null
R4043:Krt10 UTSW 11 99386993 splice site probably null
R4915:Krt10 UTSW 11 99387508 missense probably damaging 0.99
R5818:Krt10 UTSW 11 99388771 missense probably damaging 1.00
R6546:Krt10 UTSW 11 99387395 splice site probably null
R6762:Krt10 UTSW 11 99387057 missense possibly damaging 0.90
R6925:Krt10 UTSW 11 99388851 missense probably damaging 0.99
R6985:Krt10 UTSW 11 99385630 missense possibly damaging 0.66
R7196:Krt10 UTSW 11 99387545 missense probably damaging 1.00
R7772:Krt10 UTSW 11 99389087 missense unknown
R7849:Krt10 UTSW 11 99387606 missense probably damaging 1.00
R8354:Krt10 UTSW 11 99389260 unclassified probably benign
R8404:Krt10 UTSW 11 99387533 missense probably damaging 1.00
R8502:Krt10 UTSW 11 99387533 missense probably damaging 1.00
RF057:Krt10 UTSW 11 99386199 unclassified probably benign
RF062:Krt10 UTSW 11 99386199 unclassified probably benign
RF062:Krt10 UTSW 11 99389264 unclassified probably benign
X0024:Krt10 UTSW 11 99388022 missense probably damaging 1.00
X0062:Krt10 UTSW 11 99387499 missense probably null 1.00
Z1177:Krt10 UTSW 11 99386232 missense unknown
Predicted Primers PCR Primer
(F):5'- CGCCCACAAGCTGCAATTTC -3'
(R):5'- CAGCTGCTGAACAACATGAG -3'

Sequencing Primer
(F):5'- CCACAAGCTGCAATTTCGATTC -3'
(R):5'- GCCCAAATGGTCTCATCT -3'
Posted On2014-11-12