Incidental Mutation 'R2420:Krt13'
ID249225
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Namekeratin 13
SynonymsK13, Krt-1.13, Krt1-13
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R2420 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100117327-100121566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100120051 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 159 (L159Q)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
Predicted Effect probably benign
Transcript: ENSMUST00000007275
AA Change: L159Q

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: L159Q

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Meta Mutation Damage Score 0.1425 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
6820408C15Rik A G 2: 152,429,001 K48R probably damaging Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Chst9 A T 18: 15,452,284 N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Fga A T 3: 83,033,154 N705I possibly damaging Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt10 G A 11: 99,387,107 T338I possibly damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Shank3 A T 15: 89,521,210 K455* probably null Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100119713 missense probably damaging 1.00
IGL02532:Krt13 APN 11 100119369 missense probably damaging 1.00
IGL02934:Krt13 APN 11 100119084 missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100120036 missense probably damaging 0.98
R0092:Krt13 UTSW 11 100121432 nonsense probably null
R0722:Krt13 UTSW 11 100119153 missense probably damaging 1.00
R1228:Krt13 UTSW 11 100121477 missense probably benign 0.18
R1400:Krt13 UTSW 11 100121284 missense probably damaging 1.00
R1751:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R2421:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2869:Krt13 UTSW 11 100117649 missense unknown
R2869:Krt13 UTSW 11 100117649 missense unknown
R4421:Krt13 UTSW 11 100118935 missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100118001 missense unknown
R4520:Krt13 UTSW 11 100119348 missense probably damaging 0.99
R4632:Krt13 UTSW 11 100121224 missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100119363 missense probably damaging 1.00
R4872:Krt13 UTSW 11 100121506 start gained probably benign
R5709:Krt13 UTSW 11 100117643 missense unknown
R6014:Krt13 UTSW 11 100117611 missense unknown
R6323:Krt13 UTSW 11 100121150 missense probably damaging 1.00
R6391:Krt13 UTSW 11 100119376 missense probably damaging 0.96
R7535:Krt13 UTSW 11 100117998 missense unknown
R7562:Krt13 UTSW 11 100119336 missense probably damaging 1.00
R7867:Krt13 UTSW 11 100121182 missense probably damaging 1.00
R7992:Krt13 UTSW 11 100117652 missense unknown
R8379:Krt13 UTSW 11 100118880 missense probably damaging 0.99
R8429:Krt13 UTSW 11 100121125 missense probably damaging 1.00
R8560:Krt13 UTSW 11 100118850 missense possibly damaging 0.85
R8728:Krt13 UTSW 11 100121492 missense probably null 0.73
R8879:Krt13 UTSW 11 100119385 missense probably benign 0.00
X0013:Krt13 UTSW 11 100119348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTACAACTCCAAGGCCCTTG -3'
(R):5'- ACTACTGGAAGATGTTCTGAGTGG -3'

Sequencing Primer
(F):5'- AAGGCCCTTGCTCCTGGATG -3'
(R):5'- GGTGGGGCCTCTGAAATG -3'
Posted On2014-11-12