Incidental Mutation 'R2420:Krt13'
ID 249225
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Name keratin 13
Synonyms Krt1-13, K13, Krt-1.13
MMRRC Submission 040382-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R2420 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 100008153-100012392 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100010877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 159 (L159Q)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
AlphaFold P08730
Predicted Effect probably benign
Transcript: ENSMUST00000007275
AA Change: L159Q

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: L159Q

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Meta Mutation Damage Score 0.1425 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,270,921 (GRCm39) K48R probably damaging Het
Acsm2 T C 7: 119,162,857 (GRCm39) F44L probably damaging Het
Actr5 T C 2: 158,478,001 (GRCm39) F457S probably damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Ahnak C T 19: 8,986,620 (GRCm39) P2635S possibly damaging Het
Ankrd17 A T 5: 90,437,179 (GRCm39) D555E possibly damaging Het
Arhgap29 A G 3: 121,767,629 (GRCm39) I24V probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Chst9 A T 18: 15,585,341 (GRCm39) N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 (GRCm39) K73E possibly damaging Het
Dhcr24 G T 4: 106,418,291 (GRCm39) probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Egln1 T C 8: 125,674,985 (GRCm39) N270S probably benign Het
Eme1 A G 11: 94,536,640 (GRCm39) probably null Het
Emilin2 A G 17: 71,581,274 (GRCm39) I484T possibly damaging Het
Entpd2 T C 2: 25,289,295 (GRCm39) I259T probably benign Het
Fbp1 T C 13: 63,019,120 (GRCm39) K24E probably benign Het
Fga A T 3: 82,940,461 (GRCm39) N705I possibly damaging Het
Gas1 G T 13: 60,324,744 (GRCm39) probably benign Het
Glrb A G 3: 80,767,542 (GRCm39) I226T probably damaging Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm44501 A T 17: 40,889,600 (GRCm39) H38L possibly damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Jcad T C 18: 4,675,952 (GRCm39) M1238T probably damaging Het
Kank1 T C 19: 25,387,821 (GRCm39) L498S probably damaging Het
Krt10 G A 11: 99,277,933 (GRCm39) T338I possibly damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lilra6 A G 7: 3,917,857 (GRCm39) Y96H probably damaging Het
Ltc4s A G 11: 50,128,166 (GRCm39) probably null Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Mfn1 A G 3: 32,623,664 (GRCm39) I263V probably benign Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Mug2 C A 6: 122,060,419 (GRCm39) T1385K probably damaging Het
Mypn G T 10: 63,028,648 (GRCm39) Y138* probably null Het
Nav3 A C 10: 109,699,674 (GRCm39) S273R probably damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or4k42 T C 2: 111,319,602 (GRCm39) probably null Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5p51 T C 7: 107,444,025 (GRCm39) K305R probably benign Het
Pak1 A T 7: 97,503,686 (GRCm39) D7V probably benign Het
Pax3 A T 1: 78,173,501 (GRCm39) probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Prickle1 A G 15: 93,401,518 (GRCm39) F322S probably damaging Het
Prl8a2 A G 13: 27,532,896 (GRCm39) E36G possibly damaging Het
Prss45 A G 9: 110,668,160 (GRCm39) I118V possibly damaging Het
Psd4 T G 2: 24,291,253 (GRCm39) V597G probably damaging Het
Psmb10 A G 8: 106,663,934 (GRCm39) S108P probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Shank3 A T 15: 89,405,413 (GRCm39) K455* probably null Het
Spag17 T A 3: 99,934,935 (GRCm39) W714R probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Tep1 T A 14: 51,071,480 (GRCm39) H2055L probably benign Het
Terb1 T C 8: 105,225,227 (GRCm39) T14A probably damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyr T A 7: 87,078,397 (GRCm39) I488F probably benign Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Wnk1 A G 6: 119,913,328 (GRCm39) probably null Het
Zfhx4 C A 3: 5,455,465 (GRCm39) A1153E probably benign Het
Zfp13 A C 17: 23,795,186 (GRCm39) Y462D probably damaging Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100,010,539 (GRCm39) missense probably damaging 1.00
IGL02532:Krt13 APN 11 100,010,195 (GRCm39) missense probably damaging 1.00
IGL02934:Krt13 APN 11 100,009,910 (GRCm39) missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100,010,862 (GRCm39) missense probably damaging 0.98
R0092:Krt13 UTSW 11 100,012,258 (GRCm39) nonsense probably null
R0722:Krt13 UTSW 11 100,009,979 (GRCm39) missense probably damaging 1.00
R1228:Krt13 UTSW 11 100,012,303 (GRCm39) missense probably benign 0.18
R1400:Krt13 UTSW 11 100,012,110 (GRCm39) missense probably damaging 1.00
R1751:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R2421:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R4421:Krt13 UTSW 11 100,009,761 (GRCm39) missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100,008,827 (GRCm39) missense unknown
R4520:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
R4632:Krt13 UTSW 11 100,012,050 (GRCm39) missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100,010,189 (GRCm39) missense probably damaging 1.00
R4872:Krt13 UTSW 11 100,012,332 (GRCm39) start gained probably benign
R5709:Krt13 UTSW 11 100,008,469 (GRCm39) missense unknown
R6014:Krt13 UTSW 11 100,008,437 (GRCm39) missense unknown
R6323:Krt13 UTSW 11 100,011,976 (GRCm39) missense probably damaging 1.00
R6391:Krt13 UTSW 11 100,010,202 (GRCm39) missense probably damaging 0.96
R7535:Krt13 UTSW 11 100,008,824 (GRCm39) missense unknown
R7562:Krt13 UTSW 11 100,010,162 (GRCm39) missense probably damaging 1.00
R7867:Krt13 UTSW 11 100,012,008 (GRCm39) missense probably damaging 1.00
R7992:Krt13 UTSW 11 100,008,478 (GRCm39) missense unknown
R8379:Krt13 UTSW 11 100,009,706 (GRCm39) missense probably damaging 0.99
R8429:Krt13 UTSW 11 100,011,951 (GRCm39) missense probably damaging 1.00
R8560:Krt13 UTSW 11 100,009,676 (GRCm39) missense possibly damaging 0.85
R8728:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably null 0.73
R8879:Krt13 UTSW 11 100,010,211 (GRCm39) missense probably benign 0.00
R8973:Krt13 UTSW 11 100,010,264 (GRCm39) missense possibly damaging 0.83
R9610:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9611:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9746:Krt13 UTSW 11 100,011,987 (GRCm39) missense possibly damaging 0.90
X0013:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTACAACTCCAAGGCCCTTG -3'
(R):5'- ACTACTGGAAGATGTTCTGAGTGG -3'

Sequencing Primer
(F):5'- AAGGCCCTTGCTCCTGGATG -3'
(R):5'- GGTGGGGCCTCTGAAATG -3'
Posted On 2014-11-12