Incidental Mutation 'R2420:Shank3'
ID249239
Institutional Source Beutler Lab
Gene Symbol Shank3
Ensembl Gene ENSMUSG00000022623
Gene NameSH3 and multiple ankyrin repeat domains 3
Synonyms
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R2420 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89499623-89560261 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 89521210 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 455 (K455*)
Ref Sequence ENSEMBL: ENSMUSP00000104932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000066545] [ENSMUST00000109309] [ENSMUST00000229559] [ENSMUST00000230807]
Predicted Effect probably null
Transcript: ENSMUST00000039074
AA Change: K380*
SMART Domains Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: K380*

DomainStartEndE-ValueType
ANK 182 211 1.54e-1 SMART
ANK 215 245 3.36e2 SMART
ANK 249 278 2.47e0 SMART
ANK 282 311 3.71e-4 SMART
ANK 315 345 5.03e2 SMART
low complexity region 434 462 N/A INTRINSIC
SH3 473 528 1.28e-14 SMART
PDZ 579 664 3.95e-13 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 813 843 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 905 923 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1173 1194 N/A INTRINSIC
low complexity region 1235 1252 N/A INTRINSIC
low complexity region 1266 1278 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1370 1395 N/A INTRINSIC
low complexity region 1409 1427 N/A INTRINSIC
low complexity region 1552 1558 N/A INTRINSIC
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1626 1658 N/A INTRINSIC
SAM 1664 1730 3.08e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066545
SMART Domains Protein: ENSMUSP00000064477
Gene: ENSMUSG00000022623

DomainStartEndE-ValueType
ANK 109 138 1.54e-1 SMART
ANK 142 172 3.36e2 SMART
ANK 176 205 2.47e0 SMART
ANK 209 238 3.71e-4 SMART
ANK 242 272 5.03e2 SMART
low complexity region 361 389 N/A INTRINSIC
SH3 400 455 1.28e-14 SMART
PDZ 506 591 3.95e-13 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 625 636 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109309
AA Change: K455*
SMART Domains Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: K455*

DomainStartEndE-ValueType
low complexity region 5 55 N/A INTRINSIC
Pfam:FERM_f0 84 167 2.5e-14 PFAM
ANK 257 286 1.54e-1 SMART
ANK 290 320 3.36e2 SMART
ANK 324 353 2.47e0 SMART
ANK 357 386 3.71e-4 SMART
ANK 390 420 5.03e2 SMART
low complexity region 509 537 N/A INTRINSIC
SH3 548 603 1.28e-14 SMART
PDZ 654 739 3.95e-13 SMART
low complexity region 747 759 N/A INTRINSIC
low complexity region 888 918 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 980 998 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
low complexity region 1184 1196 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1310 1327 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1416 1430 N/A INTRINSIC
low complexity region 1445 1470 N/A INTRINSIC
low complexity region 1484 1502 N/A INTRINSIC
low complexity region 1627 1633 N/A INTRINSIC
low complexity region 1659 1674 N/A INTRINSIC
low complexity region 1701 1733 N/A INTRINSIC
SAM 1739 1805 3.08e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155610
Predicted Effect probably benign
Transcript: ENSMUST00000229559
Predicted Effect probably benign
Transcript: ENSMUST00000230807
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
6820408C15Rik A G 2: 152,429,001 K48R probably damaging Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Chst9 A T 18: 15,452,284 N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Fga A T 3: 83,033,154 N705I possibly damaging Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt10 G A 11: 99,387,107 T338I possibly damaging Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in Shank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Shank3 APN 15 89549416 missense probably damaging 1.00
IGL01469:Shank3 APN 15 89521274 missense probably damaging 1.00
IGL01886:Shank3 APN 15 89531663 missense probably damaging 1.00
IGL01934:Shank3 APN 15 89549846 missense probably damaging 1.00
IGL01989:Shank3 APN 15 89503299 splice site probably benign
IGL02004:Shank3 APN 15 89503299 splice site probably benign
IGL02085:Shank3 APN 15 89503915 critical splice donor site probably null
IGL02195:Shank3 APN 15 89548118 missense probably damaging 1.00
IGL02354:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02361:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02541:Shank3 APN 15 89501410 missense probably damaging 1.00
R0294:Shank3 UTSW 15 89532098 missense probably damaging 1.00
R0468:Shank3 UTSW 15 89549275 missense probably benign 0.28
R0483:Shank3 UTSW 15 89543239 splice site probably benign
R0605:Shank3 UTSW 15 89524147 missense possibly damaging 0.49
R0675:Shank3 UTSW 15 89531388 missense possibly damaging 0.92
R1082:Shank3 UTSW 15 89549371 missense probably damaging 1.00
R1576:Shank3 UTSW 15 89503663 missense probably benign 0.11
R1702:Shank3 UTSW 15 89499896 missense probably damaging 0.99
R1726:Shank3 UTSW 15 89557986 missense probably damaging 1.00
R1958:Shank3 UTSW 15 89503148 missense probably damaging 0.99
R1961:Shank3 UTSW 15 89557964 missense possibly damaging 0.60
R2513:Shank3 UTSW 15 89548686 missense probably benign 0.05
R3917:Shank3 UTSW 15 89503384 missense possibly damaging 0.77
R4163:Shank3 UTSW 15 89549594 missense probably damaging 1.00
R4205:Shank3 UTSW 15 89503318 missense probably damaging 1.00
R4434:Shank3 UTSW 15 89503359 missense probably damaging 1.00
R4791:Shank3 UTSW 15 89500354 missense probably damaging 1.00
R4816:Shank3 UTSW 15 89543115 missense probably damaging 1.00
R4828:Shank3 UTSW 15 89500199 intron probably benign
R4911:Shank3 UTSW 15 89504344 missense probably damaging 1.00
R4997:Shank3 UTSW 15 89549698 missense probably damaging 1.00
R5213:Shank3 UTSW 15 89533278 missense possibly damaging 0.82
R5338:Shank3 UTSW 15 89531711 splice site probably null
R5494:Shank3 UTSW 15 89548238 missense probably damaging 0.99
R5543:Shank3 UTSW 15 89532354 missense probably damaging 1.00
R5654:Shank3 UTSW 15 89521326 missense probably benign 0.07
R5900:Shank3 UTSW 15 89503390 missense probably damaging 1.00
R5906:Shank3 UTSW 15 89548916 missense probably damaging 1.00
R6385:Shank3 UTSW 15 89521375 critical splice donor site probably null
R6432:Shank3 UTSW 15 89503413 missense possibly damaging 0.75
R6724:Shank3 UTSW 15 89532453 missense probably damaging 1.00
R6822:Shank3 UTSW 15 89531627 missense probably damaging 1.00
R6845:Shank3 UTSW 15 89548325 missense probably benign 0.00
R7088:Shank3 UTSW 15 89503525 splice site probably null
R7390:Shank3 UTSW 15 89549312 missense probably benign 0.05
R7808:Shank3 UTSW 15 89548880 missense probably damaging 1.00
R7862:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
R8039:Shank3 UTSW 15 89505439 missense probably damaging 1.00
R8090:Shank3 UTSW 15 89505458 critical splice donor site probably null
R8170:Shank3 UTSW 15 89548840 missense possibly damaging 0.69
R8189:Shank3 UTSW 15 89549236 missense probably benign
R8246:Shank3 UTSW 15 89533346 missense possibly damaging 0.90
R8515:Shank3 UTSW 15 89503572 nonsense probably null
R8525:Shank3 UTSW 15 89547770 missense probably damaging 0.99
R8537:Shank3 UTSW 15 89532215 missense probably damaging 1.00
RF020:Shank3 UTSW 15 89500390 missense probably benign 0.20
Z1177:Shank3 UTSW 15 89558322 makesense probably null
Predicted Primers PCR Primer
(F):5'- GTGTGTACATTTATAGATATGCAGGT -3'
(R):5'- AGCTCTCGACCCATCCTGAC -3'

Sequencing Primer
(F):5'- AGCAGCTTATGTCCAGGTAC -3'
(R):5'- ATCCTGACCCTTCCTTCCAGG -3'
Posted On2014-11-12