Mutagenetix > Incidental Mutation

Incidental Mutation 'R2421:Aspm'

249259

Institutional Source

Beutler Lab

Gene Symbol

Aspm

Ensembl Gene

ENSMUSG00000033952

Gene Name

abnormal spindle microtubule assembly

Synonyms

Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1

MMRRC Submission

040383-MU

Accession Numbers

Genbank: NM_009791; MGI: 1334448

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139454772-139494091 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 139488487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1512 (V1512M)

Ref Sequence

ENSEMBL: ENSMUSP00000142880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053364
AA Change: V2777M

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: V2777M

Domain	Start	End	E-Value	Type
Pfam:ASH	29	126	8.9e-35	PFAM
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	2.41e-4	SMART
IQ	1360	1382	2.12e1	SMART
IQ	1387	1408	7.61e1	SMART
IQ	1409	1431	6.97e0	SMART
IQ	1432	1452	1.44e1	SMART
IQ	1453	1475	1.15e-1	SMART
IQ	1476	1495	1.66e2	SMART
IQ	1503	1525	1.65e-2	SMART
IQ	1526	1548	1.32e1	SMART
IQ	1549	1571	1.48e1	SMART
IQ	1572	1594	2.5e1	SMART
IQ	1599	1621	2.58e-4	SMART
IQ	1622	1644	6.7e-3	SMART
IQ	1645	1667	4.25e1	SMART
IQ	1668	1694	1.03e2	SMART
IQ	1695	1717	2.33e-2	SMART
IQ	1718	1740	7.79e0	SMART
IQ	1741	1763	1.57e2	SMART
IQ	1768	1790	2.68e-2	SMART
IQ	1791	1813	5.83e-3	SMART
IQ	1814	1836	5.93e1	SMART
IQ	1841	1863	1.92e-3	SMART
IQ	1864	1886	3.79e-2	SMART
IQ	1914	1936	4.11e0	SMART
IQ	1937	1959	1.87e-1	SMART
IQ	1960	1982	6.27e1	SMART
IQ	1987	2009	8.25e-3	SMART
IQ	2010	2032	5.73e0	SMART
IQ	2060	2082	1.39e0	SMART
IQ	2083	2105	4.62e1	SMART
IQ	2133	2155	5.58e0	SMART
IQ	2156	2178	7.07e-2	SMART
IQ	2206	2228	1.18e-3	SMART
IQ	2229	2251	4.59e0	SMART
IQ	2278	2300	1.85e-5	SMART
IQ	2301	2323	8.13e-2	SMART
IQ	2342	2364	9.62e-4	SMART
IQ	2365	2387	4.12e-3	SMART
IQ	2415	2437	7.58e-2	SMART
IQ	2438	2460	2.6e0	SMART
IQ	2490	2512	1.68e-3	SMART
IQ	2513	2535	8.51e1	SMART
IQ	2560	2582	2.14e-1	SMART
IQ	2601	2623	8.46e0	SMART
IQ	2647	2669	1.15e1	SMART
IQ	2673	2695	1.95e-4	SMART
IQ	2696	2718	4.13e1	SMART
IQ	2723	2745	1.02e-2	SMART
IQ	2761	2783	3.14e2	SMART
IQ	2784	2806	1e1	SMART
IQ	2825	2847	2.43e0	SMART
IQ	2848	2870	4.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196272

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200083
AA Change: V1512M

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952
AA Change: V1512M

Domain	Start	End	E-Value	Type
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	1.25e1	SMART
IQ	1337	1358	2.96e1	SMART
IQ	1382	1404	1.15e1	SMART
IQ	1408	1430	1.95e-4	SMART
IQ	1431	1453	4.13e1	SMART
IQ	1458	1480	1.02e-2	SMART
IQ	1496	1518	3.14e2	SMART
IQ	1519	1541	1e1	SMART
IQ	1560	1582	2.43e0	SMART
IQ	1583	1605	4.6e-1	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	C	5: 5,455,912	Y123C	probably benign	Het
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
Abraxas1	C	T	5: 100,812,174	R104H	possibly damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adcy10	T	A	1: 165,558,597	L1118Q	probably damaging	Het
Adgre4	A	G	17: 55,778,872	E57G	probably benign	Het
Alpk2	T	C	18: 65,306,616	S1036G	probably benign	Het
Ank3	T	C	10: 69,982,204		probably benign	Het
Ankfy1	T	A	11: 72,755,896		probably benign	Het
Antxrl	A	G	14: 34,071,689		probably benign	Het
Apaf1	A	T	10: 91,020,723	V874D	probably damaging	Het
Arhgap39	T	A	15: 76,725,146	T1025S	probably damaging	Het
Arhgef12	A	T	9: 43,001,006	C519S	probably damaging	Het
Atp13a3	T	C	16: 30,349,825	T449A	probably benign	Het
Atxn2	A	T	5: 121,802,079		probably null	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Camk2d	A	G	3: 126,780,415	D157G	probably damaging	Het
Ccdc122	T	C	14: 77,091,663		probably benign	Het
Ccdc137	G	A	11: 120,462,264		probably null	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Col4a3	G	A	1: 82,670,275		probably benign	Het
Coq10b	G	A	1: 55,052,977	A35T	probably benign	Het
Creb3l3	T	C	10: 81,091,818	I47V	probably benign	Het
Csgalnact1	A	T	8: 68,461,508	I15N	probably benign	Het
Dcp1b	A	G	6: 119,215,266	Q381R	probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Dnal1	C	T	12: 84,136,706	Q80*	probably null	Het
Dtd2	A	G	12: 51,999,855	V67A	probably benign	Het
Gart	A	G	16: 91,643,040		probably null	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm6327	T	C	16: 12,760,094		noncoding transcript	Het
Gm8674	T	C	13: 49,900,663		noncoding transcript	Het
Gpr107	G	A	2: 31,185,529	G351S	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Krt13	A	T	11: 100,120,051	L159Q	probably benign	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lenep	G	A	3: 89,402,574		probably null	Het
Lrp1b	T	C	2: 40,882,133		probably benign	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Lyn	C	T	4: 3,748,787	A255V	possibly damaging	Het
Mdn1	T	A	4: 32,723,621	I2519K	probably damaging	Het
Mmaa	T	A	8: 79,281,432	R59W	probably damaging	Het
Ms4a4b	A	G	19: 11,454,697	I61V	possibly damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Olfr1219	T	C	2: 89,074,992	Y33C	possibly damaging	Het
Olfr175-ps1	T	C	16: 58,824,346	D121G	probably damaging	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr211	T	A	6: 116,493,713	C35S	probably benign	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pef1	C	A	4: 130,127,317	C221*	probably null	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Pnliprp1	T	A	19: 58,744,085	I460N	probably benign	Het
Ppfia4	T	C	1: 134,327,400	N239S	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Prlr	T	A	15: 10,319,257	W91R	probably damaging	Het
Psmd2	T	A	16: 20,660,106		probably null	Het
Ptprt	T	A	2: 162,278,040		probably benign	Het
Rbm12b2	T	C	4: 12,095,127	F662S	possibly damaging	Het
Rgs6	C	A	12: 83,116,283	T421K	possibly damaging	Het
Ryr2	T	G	13: 11,591,237	Q4486H	probably damaging	Het
Scn7a	A	T	2: 66,726,302		probably benign	Het
Smc1a	A	G	X: 152,047,975		probably benign	Het
Synrg	A	G	11: 84,009,224	E674G	probably damaging	Het
Syt9	G	A	7: 107,436,781	R335K	probably benign	Het
Taar7a	T	C	10: 23,992,517	N322S	probably damaging	Het
Tfb2m	C	A	1: 179,533,666	W252C	possibly damaging	Het
Tmub2	T	A	11: 102,287,755	D161E	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw1	A	T	5: 130,269,260	H214L	probably damaging	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vangl2	T	C	1: 172,007,959	Y382C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Vps13a	T	G	19: 16,759,671	I101L	probably benign	Het
Washc4	T	A	10: 83,579,521	F792I	probably damaging	Het
Wdhd1	G	A	14: 47,258,584	H608Y	probably benign	Het
Wdr48	T	A	9: 119,902,404	I56K	probably damaging	Het
Xpo4	T	C	14: 57,629,503	D194G	probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp821	T	A	8: 109,709,533		probably null	Het
Zswim8	A	G	14: 20,719,457	Y1237C	probably damaging	Het

Other mutations in Aspm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Aspm	APN	1	139478691	missense	probably damaging	1.00
IGL00594:Aspm	APN	1	139487422	splice site	probably benign
IGL00808:Aspm	APN	1	139461476	missense	probably benign	0.03
IGL00897:Aspm	APN	1	139477407	missense	probably damaging	0.98
IGL01024:Aspm	APN	1	139478124	missense	possibly damaging	0.66
IGL01410:Aspm	APN	1	139482444	missense	probably benign	0.25
IGL01588:Aspm	APN	1	139478162	missense	probably benign	0.11
IGL01610:Aspm	APN	1	139489670	nonsense	probably null
IGL01633:Aspm	APN	1	139480836	missense	possibly damaging	0.93
IGL01982:Aspm	APN	1	139491588	missense	probably benign	0.12
IGL02429:Aspm	APN	1	139479810	missense	probably benign	0.27
IGL02468:Aspm	APN	1	139480950	missense	probably damaging	1.00
IGL02519:Aspm	APN	1	139461927	splice site	probably benign
IGL02526:Aspm	APN	1	139489719	missense	probably benign	0.03
IGL02716:Aspm	APN	1	139479687	missense	probably damaging	1.00
IGL02876:Aspm	APN	1	139473653	missense	probably damaging	1.00
IGL02953:Aspm	APN	1	139457419	missense	probably benign	0.01
IGL03275:Aspm	APN	1	139487295	missense	probably damaging	1.00
Stemware	UTSW	1	139477459	nonsense	probably null
3-1:Aspm	UTSW	1	139457541	missense	probably benign
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0140:Aspm	UTSW	1	139480641	missense	probably benign	0.00
R0195:Aspm	UTSW	1	139479135	missense	probably damaging	1.00
R0217:Aspm	UTSW	1	139457880	missense	possibly damaging	0.46
R0276:Aspm	UTSW	1	139478471	missense	possibly damaging	0.95
R0309:Aspm	UTSW	1	139482511	splice site	probably benign
R0466:Aspm	UTSW	1	139477901	missense	probably damaging	1.00
R0520:Aspm	UTSW	1	139478820	missense	possibly damaging	0.51
R0615:Aspm	UTSW	1	139487289	missense	probably damaging	1.00
R0626:Aspm	UTSW	1	139491601	missense	probably damaging	1.00
R0660:Aspm	UTSW	1	139457764	missense	probably benign	0.03
R0751:Aspm	UTSW	1	139456898	splice site	probably benign
R0830:Aspm	UTSW	1	139474254	missense	probably damaging	0.99
R1109:Aspm	UTSW	1	139456758	missense	probably damaging	0.99
R1114:Aspm	UTSW	1	139461924	splice site	probably benign
R1130:Aspm	UTSW	1	139477834	missense	possibly damaging	0.90
R1298:Aspm	UTSW	1	139457419	missense	probably benign	0.01
R1386:Aspm	UTSW	1	139457623	missense	probably benign	0.03
R1386:Aspm	UTSW	1	139478972	missense	possibly damaging	0.80
R1557:Aspm	UTSW	1	139468668	missense	probably benign	0.01
R1625:Aspm	UTSW	1	139481039	missense	probably benign	0.01
R1728:Aspm	UTSW	1	139473574	missense	probably benign
R1729:Aspm	UTSW	1	139473574	missense	probably benign
R1730:Aspm	UTSW	1	139473574	missense	probably benign
R1733:Aspm	UTSW	1	139457117	missense	probably benign	0.27
R1739:Aspm	UTSW	1	139473574	missense	probably benign
R1762:Aspm	UTSW	1	139473574	missense	probably benign
R1783:Aspm	UTSW	1	139473574	missense	probably benign
R1784:Aspm	UTSW	1	139473574	missense	probably benign
R1785:Aspm	UTSW	1	139473574	missense	probably benign
R1793:Aspm	UTSW	1	139457341	missense	probably benign	0.00
R1893:Aspm	UTSW	1	139479867	missense	probably damaging	1.00
R1911:Aspm	UTSW	1	139478094	missense	probably benign	0.06
R2103:Aspm	UTSW	1	139491665	missense	probably damaging	0.99
R2128:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2129:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2239:Aspm	UTSW	1	139456846	missense	possibly damaging	0.67
R2352:Aspm	UTSW	1	139457562	missense	probably benign	0.02
R2353:Aspm	UTSW	1	139477697	missense	probably damaging	1.00
R2380:Aspm	UTSW	1	139479348	missense	probably damaging	1.00
R2413:Aspm	UTSW	1	139477757	missense	probably damaging	1.00
R3607:Aspm	UTSW	1	139480668	missense	probably benign	0.13
R3711:Aspm	UTSW	1	139458100	missense	probably benign	0.17
R3718:Aspm	UTSW	1	139480889	missense	probably benign	0.09
R3718:Aspm	UTSW	1	139490427	missense	probably benign	0.31
R3741:Aspm	UTSW	1	139478619	missense	possibly damaging	0.47
R3788:Aspm	UTSW	1	139463203	missense	probably damaging	1.00
R3838:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3839:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3849:Aspm	UTSW	1	139458286	missense	probably benign	0.21
R4075:Aspm	UTSW	1	139474285	missense	probably damaging	1.00
R4080:Aspm	UTSW	1	139470755	missense	probably damaging	1.00
R4463:Aspm	UTSW	1	139455010	missense	possibly damaging	0.95
R4537:Aspm	UTSW	1	139474303	missense	probably benign	0.01
R4547:Aspm	UTSW	1	139478187	missense	possibly damaging	0.75
R4573:Aspm	UTSW	1	139479507	missense	probably damaging	0.98
R4680:Aspm	UTSW	1	139480671	missense	probably benign	0.05
R4807:Aspm	UTSW	1	139477919	missense	probably damaging	1.00
R4840:Aspm	UTSW	1	139470531	missense	possibly damaging	0.83
R4854:Aspm	UTSW	1	139478072	nonsense	probably null
R4859:Aspm	UTSW	1	139469393	missense	probably damaging	1.00
R4893:Aspm	UTSW	1	139489839	critical splice donor site	probably null
R4910:Aspm	UTSW	1	139491543	missense	probably damaging	1.00
R4953:Aspm	UTSW	1	139471734	missense	probably benign	0.00
R4974:Aspm	UTSW	1	139478010	missense	probably benign	0.03
R4981:Aspm	UTSW	1	139470760	splice site	probably null
R5082:Aspm	UTSW	1	139478676	nonsense	probably null
R5223:Aspm	UTSW	1	139478334	missense	probably damaging	1.00
R5268:Aspm	UTSW	1	139464295	missense	probably damaging	1.00
R5371:Aspm	UTSW	1	139470541	nonsense	probably null
R5377:Aspm	UTSW	1	139457483	missense	probably damaging	0.96
R5377:Aspm	UTSW	1	139470395	splice site	probably null
R5481:Aspm	UTSW	1	139457061	missense	possibly damaging	0.85
R5513:Aspm	UTSW	1	139482398	missense	probably damaging	1.00
R5578:Aspm	UTSW	1	139470717	missense	probably damaging	1.00
R5649:Aspm	UTSW	1	139479669	missense	probably benign
R5685:Aspm	UTSW	1	139487288	missense	probably benign	0.10
R5695:Aspm	UTSW	1	139479669	missense	probably benign
R5766:Aspm	UTSW	1	139479002	missense	probably damaging	0.99
R5964:Aspm	UTSW	1	139455227	intron	probably benign
R5993:Aspm	UTSW	1	139479531	missense	probably benign	0.28
R6027:Aspm	UTSW	1	139463056	missense	probably damaging	1.00
R6029:Aspm	UTSW	1	139480990	missense	possibly damaging	0.83
R6102:Aspm	UTSW	1	139477459	nonsense	probably null
R6188:Aspm	UTSW	1	139479239	missense	possibly damaging	0.79
R6257:Aspm	UTSW	1	139482053	splice site	probably null
R6433:Aspm	UTSW	1	139473683	missense	probably damaging	1.00
R6682:Aspm	UTSW	1	139457722	missense	possibly damaging	0.67
R6763:Aspm	UTSW	1	139470517	missense	possibly damaging	0.64
R6798:Aspm	UTSW	1	139468685	missense	possibly damaging	0.66
R6815:Aspm	UTSW	1	139480142	missense	probably benign	0.04
R6854:Aspm	UTSW	1	139463182	missense	possibly damaging	0.90
R6928:Aspm	UTSW	1	139480206	nonsense	probably null
R6943:Aspm	UTSW	1	139480542	missense	probably damaging	1.00
R6979:Aspm	UTSW	1	139480485	missense	probably damaging	1.00
R6998:Aspm	UTSW	1	139469472	missense	probably damaging	1.00
R7126:Aspm	UTSW	1	139480803	missense	probably benign	0.27
R7237:Aspm	UTSW	1	139477929	missense	possibly damaging	0.81
R7240:Aspm	UTSW	1	139478651	nonsense	probably null
R7272:Aspm	UTSW	1	139458328	missense	probably benign	0.14
R7427:Aspm	UTSW	1	139457616	missense	probably benign	0.01
R7519:Aspm	UTSW	1	139490336	missense	possibly damaging	0.53
R7776:Aspm	UTSW	1	139479846	missense	possibly damaging	0.85
R7875:Aspm	UTSW	1	139455134	missense	probably benign	0.02
R7883:Aspm	UTSW	1	139478667	missense	possibly damaging	0.47
R7964:Aspm	UTSW	1	139480686	missense	probably damaging	1.00
R8012:Aspm	UTSW	1	139457464	missense	probably benign	0.03
R8029:Aspm	UTSW	1	139471632	missense	probably benign	0.00
R8233:Aspm	UTSW	1	139457304	missense	probably benign	0.28
R8277:Aspm	UTSW	1	139455010	missense	probably damaging	1.00
R8345:Aspm	UTSW	1	139464273	nonsense	probably null
R8491:Aspm	UTSW	1	139457695	missense	probably damaging	0.98
R8511:Aspm	UTSW	1	139457308	missense	probably damaging	1.00
R8557:Aspm	UTSW	1	139456756	missense	probably benign	0.01
R8927:Aspm	UTSW	1	139490387	nonsense	probably null
R8928:Aspm	UTSW	1	139490387	nonsense	probably null
R8950:Aspm	UTSW	1	139478952	missense	probably damaging	1.00
R9033:Aspm	UTSW	1	139478127	missense	probably damaging	1.00
R9083:Aspm	UTSW	1	139493698	missense	possibly damaging	0.70
R9133:Aspm	UTSW	1	139491528	missense	probably damaging	1.00
R9160:Aspm	UTSW	1	139490124	missense	probably damaging	1.00
R9179:Aspm	UTSW	1	139476715	missense	probably damaging	1.00
R9265:Aspm	UTSW	1	139461444	missense	probably benign	0.24
R9400:Aspm	UTSW	1	139479903	missense	probably damaging	1.00
R9419:Aspm	UTSW	1	139457185	missense	probably benign	0.29
R9454:Aspm	UTSW	1	139480994	missense	probably benign	0.00
R9517:Aspm	UTSW	1	139479429	missense	probably damaging	1.00
R9524:Aspm	UTSW	1	139480869	missense	probably damaging	1.00
R9544:Aspm	UTSW	1	139457785	missense	probably benign	0.01
R9640:Aspm	UTSW	1	139480272	missense	possibly damaging	0.88
R9698:Aspm	UTSW	1	139461908	missense	probably benign	0.28
R9790:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9791:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9794:Aspm	UTSW	1	139478742	missense	probably damaging	0.99
X0063:Aspm	UTSW	1	139458090	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCAAAGGGCCCAAAATTCTACTTTTAC -3'
(R):5'- TGGGACTGTATGTAAGCACATC -3'

Sequencing Primer
(F):5'- ACAGTTTGTGTGCATTTTTCATATGC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'

Posted On

2014-11-12