Incidental Mutation 'R2421:Tfb2m'
ID 249262
Institutional Source Beutler Lab
Gene Symbol Tfb2m
Ensembl Gene ENSMUSG00000026492
Gene Name transcription factor B2, mitochondrial
Synonyms Hkp1
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.898) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 179355620-179373832 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 179361231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Cysteine at position 252 (W252C)
Ref Sequence ENSEMBL: ENSMUSP00000027769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027769]
AlphaFold Q3TL26
Predicted Effect possibly damaging
Transcript: ENSMUST00000027769
AA Change: W252C

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027769
Gene: ENSMUSG00000026492
AA Change: W252C

DomainStartEndE-ValueType
Pfam:RrnaAD 79 377 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150778
Meta Mutation Damage Score 0.4337 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Tfb2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Tfb2m APN 1 179,369,878 (GRCm39) missense probably damaging 1.00
IGL01415:Tfb2m APN 1 179,359,695 (GRCm39) splice site probably benign
IGL01538:Tfb2m APN 1 179,365,409 (GRCm39) missense possibly damaging 0.87
IGL01939:Tfb2m APN 1 179,365,262 (GRCm39) critical splice donor site probably null
IGL02434:Tfb2m APN 1 179,359,700 (GRCm39) splice site probably benign
IGL02795:Tfb2m APN 1 179,373,524 (GRCm39) missense possibly damaging 0.88
R0267:Tfb2m UTSW 1 179,361,203 (GRCm39) missense probably benign 0.10
R0504:Tfb2m UTSW 1 179,373,396 (GRCm39) missense probably damaging 1.00
R0514:Tfb2m UTSW 1 179,358,869 (GRCm39) missense probably benign 0.05
R0518:Tfb2m UTSW 1 179,365,389 (GRCm39) missense possibly damaging 0.47
R0762:Tfb2m UTSW 1 179,373,398 (GRCm39) missense probably damaging 1.00
R1542:Tfb2m UTSW 1 179,365,426 (GRCm39) splice site probably null
R1697:Tfb2m UTSW 1 179,372,464 (GRCm39) missense probably null 1.00
R5384:Tfb2m UTSW 1 179,373,437 (GRCm39) splice site probably null
R5583:Tfb2m UTSW 1 179,373,446 (GRCm39) missense probably benign 0.16
R6522:Tfb2m UTSW 1 179,373,611 (GRCm39) missense probably benign 0.45
R7425:Tfb2m UTSW 1 179,365,269 (GRCm39) missense probably benign 0.08
R7480:Tfb2m UTSW 1 179,356,747 (GRCm39) missense probably benign
R7846:Tfb2m UTSW 1 179,358,926 (GRCm39) missense probably damaging 1.00
R8207:Tfb2m UTSW 1 179,373,668 (GRCm39) missense probably benign 0.05
R8286:Tfb2m UTSW 1 179,356,770 (GRCm39) missense probably damaging 1.00
R8337:Tfb2m UTSW 1 179,369,914 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGTGTCAGTGTTAATCTCCTCTC -3'
(R):5'- ACTCTACTTGAAAGTTCTCGTGG -3'

Sequencing Primer
(F):5'- TTTAATCCTAGCACTCAGGAGGCAG -3'
(R):5'- CCTCCTGAGAACTAGGTTTAAAGGC -3'
Posted On 2014-11-12