Mutagenetix > Incidental Mutation

Incidental Mutation 'R0305:Zfpm2'

24927

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

038516-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0305 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 40774035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably benign
Transcript: ENSMUST00000053467

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229777

Predicted Effect

probably benign
Transcript: ENSMUST00000230319

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230723

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	G	A	7: 27,574,636	R183Q	probably damaging	Het
Abca5	A	G	11: 110,273,311		probably benign	Het
Ada	T	C	2: 163,728,157	K312R	probably benign	Het
Adam21	C	A	12: 81,560,285	K234N	possibly damaging	Het
Afdn	T	A	17: 13,888,514		probably null	Het
Aimp1	T	G	3: 132,673,986	K132Q	possibly damaging	Het
Aldh16a1	C	T	7: 45,147,979	R135Q	probably damaging	Het
Alox12b	A	T	11: 69,167,379	Y519F	probably benign	Het
Alppl2	T	C	1: 87,089,602	E25G	probably benign	Het
Apob	A	T	12: 8,012,210	N3531I	probably damaging	Het
Arhgap23	T	C	11: 97,501,109	L321P	probably damaging	Het
Cab39l	C	T	14: 59,519,579	Q137*	probably null	Het
Cenpo	A	T	12: 4,216,660	H149Q	possibly damaging	Het
Cpt1a	A	G	19: 3,378,455	T610A	probably benign	Het
Dcbld2	A	G	16: 58,448,939	T271A	probably damaging	Het
Dcps	A	G	9: 35,175,769		probably null	Het
Dnaic2	A	G	11: 114,752,894	D462G	probably benign	Het
Dsg2	T	A	18: 20,582,695		probably benign	Het
Eomes	A	T	9: 118,484,757	E623D	probably benign	Het
Fam19a5	T	A	15: 87,720,508	I83N	probably damaging	Het
Fras1	A	T	5: 96,596,888	H594L	probably benign	Het
Gad1-ps	T	G	10: 99,444,803		noncoding transcript	Het
Galk2	A	G	2: 125,887,888	Y63C	probably damaging	Het
H2-T10	A	G	17: 36,119,368	L227P	probably damaging	Het
Itgb4	T	G	11: 115,979,412	C73G	probably damaging	Het
Itpr2	T	C	6: 146,311,103	H1472R	possibly damaging	Het
Kcnh5	C	T	12: 75,114,397	A246T	probably benign	Het
Kpna6	G	T	4: 129,649,249	R458S	probably benign	Het
Lifr	A	G	15: 7,177,501	T498A	probably damaging	Het
Lrrd1	T	G	5: 3,865,707	I768S	probably damaging	Het
Map2	T	C	1: 66,413,094	V223A	probably benign	Het
Nod2	G	A	8: 88,665,323	A731T	probably damaging	Het
Nrxn2	G	A	19: 6,519,283	C1403Y	probably damaging	Het
Nxph1	A	T	6: 9,247,754	I242F	probably damaging	Het
Olfr507	G	A	7: 108,622,585	V258I	probably benign	Het
Pgr	A	G	9: 8,902,087		probably benign	Het
Pik3cb	A	G	9: 99,064,076	S566P	possibly damaging	Het
Sema4d	T	C	13: 51,712,728	Y242C	probably damaging	Het
Sftpc	T	A	14: 70,524,078		probably benign	Het
Sh3tc1	T	G	5: 35,723,999	E33D	probably benign	Het
Slc17a5	A	G	9: 78,557,537	L344P	probably benign	Het
Slc39a5	T	A	10: 128,398,396		probably benign	Het
Slc7a13	C	A	4: 19,839,401	H335N	probably benign	Het
Slco1a4	A	C	6: 141,817,753	N412K	possibly damaging	Het
Sox1	A	T	8: 12,396,736	T126S	probably damaging	Het
Specc1l	T	A	10: 75,245,829	V353E	probably damaging	Het
Stat5b	T	C	11: 100,802,503	E104G	probably benign	Het
Sult4a1	A	G	15: 84,086,667	V179A	probably damaging	Het
Tbl3	G	A	17: 24,705,461	R134C	probably damaging	Het
Tmem256	T	A	11: 69,838,911		probably benign	Het
Tmigd1	A	G	11: 76,907,134	T101A	probably damaging	Het
Unc5b	C	A	10: 60,779,658		probably benign	Het
Unc79	T	A	12: 103,113,200	S1679T	probably benign	Het
Vmn2r1	T	G	3: 64,089,666	C248G	probably damaging	Het
Vmn2r57	T	C	7: 41,427,543	I400V	probably benign	Het
Vwa8	T	A	14: 79,009,273	L685H	probably damaging	Het
Yeats4	A	G	10: 117,215,836	F172S	probably damaging	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CTTCACTATGTCGTCTGCTGAGAAGAG -3'
(R):5'- AGTCTTCAAGCTGAGGTGAAAAGTTGTT -3'

Sequencing Primer
(F):5'- GGTCACTATGTTTGTTGTATCCAAAG -3'
(R):5'- cacacacacacacacacac -3'

Posted On

2013-04-16