Incidental Mutation 'R2421:Camk2d'
ID 249270
Institutional Source Beutler Lab
Gene Symbol Camk2d
Ensembl Gene ENSMUSG00000053819
Gene Name calcium/calmodulin-dependent protein kinase II, delta
Synonyms CaMK II, 8030469K03Rik, 2810011D23Rik
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R2421 (G1)
Quality Score 200
Status Validated
Chromosome 3
Chromosomal Location 126389951-126639975 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126574064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 157 (D157G)
Ref Sequence ENSEMBL: ENSMUSP00000143677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066466] [ENSMUST00000106399] [ENSMUST00000106400] [ENSMUST00000106401] [ENSMUST00000106402] [ENSMUST00000171289] [ENSMUST00000163226] [ENSMUST00000199300] [ENSMUST00000200171] [ENSMUST00000134466] [ENSMUST00000145454]
AlphaFold Q6PHZ2
Predicted Effect probably damaging
Transcript: ENSMUST00000066466
AA Change: D157G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063359
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 7.4e-67 PFAM
Pfam:DUF4440 350 464 4.7e-13 PFAM
Pfam:SnoaL_3 350 476 3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106399
AA Change: D157G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102007
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 357 484 3.5e-67 PFAM
Pfam:DUF4440 361 475 5.4e-13 PFAM
Pfam:SnoaL_3 361 487 3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106400
AA Change: D157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102008
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 4.7e-67 PFAM
Pfam:DUF4440 350 464 3.2e-13 PFAM
Pfam:SnoaL_3 350 476 2.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106401
AA Change: D157G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102009
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.8e-67 PFAM
Pfam:DUF4440 384 498 5.8e-13 PFAM
Pfam:SnoaL_3 384 510 3.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106402
AA Change: D157G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102010
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 1.1e-66 PFAM
Pfam:DUF4440 384 498 8.1e-13 PFAM
Pfam:SnoaL_3 384 510 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129293
Predicted Effect probably damaging
Transcript: ENSMUST00000171289
AA Change: D157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129999
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.3e-63 PFAM
Pfam:DUF4440 384 498 3.2e-12 PFAM
Pfam:SnoaL_3 384 509 8.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131869
SMART Domains Protein: ENSMUSP00000126412
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 1 109 5.1e-26 PFAM
Pfam:Pkinase_Tyr 3 111 4.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163226
AA Change: D157G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133019
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199300
AA Change: D157G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143504
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 1.3e-62 PFAM
Pfam:DUF4440 350 464 1.7e-11 PFAM
Pfam:SnoaL_3 350 475 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200171
AA Change: D157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143677
Gene: ENSMUSG00000053819
AA Change: D157G

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 9.8e-63 PFAM
Pfam:DUF4440 384 498 2.5e-11 PFAM
Pfam:SnoaL_3 384 509 5.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169051
SMART Domains Protein: ENSMUSP00000132554
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 6.9e-67 PFAM
Pfam:DUF4440 350 464 4.3e-13 PFAM
Pfam:SnoaL_3 350 476 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134466
SMART Domains Protein: ENSMUSP00000114801
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1e-33 PFAM
Pfam:Pkinase_Tyr 14 141 4.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145454
SMART Domains Protein: ENSMUSP00000130769
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1.4e-33 PFAM
Pfam:Pkinase_Tyr 14 142 4.7e-16 PFAM
Meta Mutation Damage Score 0.9686 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced response to heart induced stress. Mice homozygous for an allele that produces an oxidant-resistant product exhibit reduced response to myocardial infarction in a diabetic model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Camk2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Camk2d APN 3 126,631,921 (GRCm39) nonsense probably null
IGL01113:Camk2d APN 3 126,574,061 (GRCm39) missense probably damaging 1.00
IGL01125:Camk2d APN 3 126,591,934 (GRCm39) splice site probably benign
IGL01912:Camk2d APN 3 126,604,281 (GRCm39) splice site probably null
IGL01934:Camk2d APN 3 126,628,304 (GRCm39) splice site probably null
IGL02184:Camk2d APN 3 126,591,422 (GRCm39) missense probably damaging 0.97
IGL02218:Camk2d APN 3 126,633,802 (GRCm39) missense probably benign 0.00
IGL02804:Camk2d APN 3 126,591,387 (GRCm39) missense possibly damaging 0.53
IGL03347:Camk2d APN 3 126,590,550 (GRCm39) missense probably damaging 1.00
IGL03354:Camk2d APN 3 126,590,615 (GRCm39) splice site probably null
baryon UTSW 3 126,391,131 (GRCm39) nonsense probably null
Neutron UTSW 3 126,574,069 (GRCm39) missense probably damaging 1.00
R0024:Camk2d UTSW 3 126,591,372 (GRCm39) missense probably benign 0.01
R0024:Camk2d UTSW 3 126,591,372 (GRCm39) missense probably benign 0.01
R0628:Camk2d UTSW 3 126,604,273 (GRCm39) splice site probably benign
R1114:Camk2d UTSW 3 126,633,941 (GRCm39) missense probably damaging 1.00
R1433:Camk2d UTSW 3 126,601,873 (GRCm39) missense probably benign 0.25
R2021:Camk2d UTSW 3 126,574,105 (GRCm39) missense probably damaging 1.00
R2096:Camk2d UTSW 3 126,574,091 (GRCm39) missense probably damaging 1.00
R2098:Camk2d UTSW 3 126,574,091 (GRCm39) missense probably damaging 1.00
R2437:Camk2d UTSW 3 126,628,277 (GRCm39) missense probably damaging 1.00
R2930:Camk2d UTSW 3 126,601,880 (GRCm39) missense possibly damaging 0.86
R3738:Camk2d UTSW 3 126,565,488 (GRCm39) missense probably damaging 1.00
R3969:Camk2d UTSW 3 126,590,608 (GRCm39) missense possibly damaging 0.81
R4455:Camk2d UTSW 3 126,574,052 (GRCm39) missense probably damaging 1.00
R4829:Camk2d UTSW 3 126,573,646 (GRCm39) intron probably benign
R4916:Camk2d UTSW 3 126,577,624 (GRCm39) missense probably damaging 1.00
R5277:Camk2d UTSW 3 126,478,390 (GRCm39) intron probably benign
R5329:Camk2d UTSW 3 126,391,131 (GRCm39) nonsense probably null
R5364:Camk2d UTSW 3 126,574,069 (GRCm39) missense probably damaging 1.00
R5473:Camk2d UTSW 3 126,391,048 (GRCm39) utr 5 prime probably benign
R5509:Camk2d UTSW 3 126,633,965 (GRCm39) missense probably damaging 1.00
R5958:Camk2d UTSW 3 126,573,514 (GRCm39) intron probably benign
R6010:Camk2d UTSW 3 126,591,363 (GRCm39) missense possibly damaging 0.83
R6145:Camk2d UTSW 3 126,599,507 (GRCm39) missense probably benign
R7267:Camk2d UTSW 3 126,591,379 (GRCm39) missense possibly damaging 0.59
R7708:Camk2d UTSW 3 126,391,089 (GRCm39) start codon destroyed probably benign 0.00
R8249:Camk2d UTSW 3 126,591,378 (GRCm39) missense probably damaging 1.00
R8554:Camk2d UTSW 3 126,564,448 (GRCm39) missense possibly damaging 0.92
R9489:Camk2d UTSW 3 126,561,209 (GRCm39) missense probably damaging 1.00
R9698:Camk2d UTSW 3 126,633,833 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AACAGTGCATGAGTTTGCTTCC -3'
(R):5'- GGGATCCAGTGTGTTAAAATTAGTG -3'

Sequencing Primer
(F):5'- CTGCCCTGTTTAATCTTGTACAAATG -3'
(R):5'- GAAGATGTTGCTAGAGTCCCC -3'
Posted On 2014-11-12