Mutagenetix > Incidental Mutation

Incidental Mutation 'R2421:Lyn'

249271

Institutional Source

Beutler Lab

Gene Symbol

Lyn

Ensembl Gene

ENSMUSG00000042228

Gene Name

LYN proto-oncogene, Src family tyrosine kinase

Synonyms

Hck-2

MMRRC Submission

040383-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3678115-3813122 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3748787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 255 (A255V)

Ref Sequence

ENSEMBL: ENSMUSP00000038838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]

AlphaFold

P25911

PDB Structure

Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION]
Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041377
AA Change: A255V

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: A255V

Domain	Start	End	E-Value	Type
SH3	66	122	9.24e-21	SMART
SH2	127	217	5.38e-33	SMART
TyrKc	247	497	3.25e-137	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000103010
AA Change: A234V

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: A234V

Domain	Start	End	E-Value	Type
SH3	45	101	5.8e-23	SMART
SH2	106	196	3.3e-35	SMART
TyrKc	226	476	1.6e-139	SMART

Meta Mutation Damage Score

0.2044

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	C	5: 5,455,912	Y123C	probably benign	Het
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
Abraxas1	C	T	5: 100,812,174	R104H	possibly damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adcy10	T	A	1: 165,558,597	L1118Q	probably damaging	Het
Adgre4	A	G	17: 55,778,872	E57G	probably benign	Het
Alpk2	T	C	18: 65,306,616	S1036G	probably benign	Het
Ank3	T	C	10: 69,982,204		probably benign	Het
Ankfy1	T	A	11: 72,755,896		probably benign	Het
Antxrl	A	G	14: 34,071,689		probably benign	Het
Apaf1	A	T	10: 91,020,723	V874D	probably damaging	Het
Arhgap39	T	A	15: 76,725,146	T1025S	probably damaging	Het
Arhgef12	A	T	9: 43,001,006	C519S	probably damaging	Het
Aspm	G	A	1: 139,488,487	V1512M	possibly damaging	Het
Atp13a3	T	C	16: 30,349,825	T449A	probably benign	Het
Atxn2	A	T	5: 121,802,079		probably null	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Camk2d	A	G	3: 126,780,415	D157G	probably damaging	Het
Ccdc122	T	C	14: 77,091,663		probably benign	Het
Ccdc137	G	A	11: 120,462,264		probably null	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Col4a3	G	A	1: 82,670,275		probably benign	Het
Coq10b	G	A	1: 55,052,977	A35T	probably benign	Het
Creb3l3	T	C	10: 81,091,818	I47V	probably benign	Het
Csgalnact1	A	T	8: 68,461,508	I15N	probably benign	Het
Dcp1b	A	G	6: 119,215,266	Q381R	probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Dnal1	C	T	12: 84,136,706	Q80*	probably null	Het
Dtd2	A	G	12: 51,999,855	V67A	probably benign	Het
Gart	A	G	16: 91,643,040		probably null	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm6327	T	C	16: 12,760,094		noncoding transcript	Het
Gm8674	T	C	13: 49,900,663		noncoding transcript	Het
Gpr107	G	A	2: 31,185,529	G351S	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Krt13	A	T	11: 100,120,051	L159Q	probably benign	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lenep	G	A	3: 89,402,574		probably null	Het
Lrp1b	T	C	2: 40,882,133		probably benign	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Mdn1	T	A	4: 32,723,621	I2519K	probably damaging	Het
Mmaa	T	A	8: 79,281,432	R59W	probably damaging	Het
Ms4a4b	A	G	19: 11,454,697	I61V	possibly damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Olfr1219	T	C	2: 89,074,992	Y33C	possibly damaging	Het
Olfr175-ps1	T	C	16: 58,824,346	D121G	probably damaging	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr211	T	A	6: 116,493,713	C35S	probably benign	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pef1	C	A	4: 130,127,317	C221*	probably null	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Pnliprp1	T	A	19: 58,744,085	I460N	probably benign	Het
Ppfia4	T	C	1: 134,327,400	N239S	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Prlr	T	A	15: 10,319,257	W91R	probably damaging	Het
Psmd2	T	A	16: 20,660,106		probably null	Het
Ptprt	T	A	2: 162,278,040		probably benign	Het
Rbm12b2	T	C	4: 12,095,127	F662S	possibly damaging	Het
Rgs6	C	A	12: 83,116,283	T421K	possibly damaging	Het
Ryr2	T	G	13: 11,591,237	Q4486H	probably damaging	Het
Scn7a	A	T	2: 66,726,302		probably benign	Het
Smc1a	A	G	X: 152,047,975		probably benign	Het
Synrg	A	G	11: 84,009,224	E674G	probably damaging	Het
Syt9	G	A	7: 107,436,781	R335K	probably benign	Het
Taar7a	T	C	10: 23,992,517	N322S	probably damaging	Het
Tfb2m	C	A	1: 179,533,666	W252C	possibly damaging	Het
Tmub2	T	A	11: 102,287,755	D161E	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw1	A	T	5: 130,269,260	H214L	probably damaging	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vangl2	T	C	1: 172,007,959	Y382C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Vps13a	T	G	19: 16,759,671	I101L	probably benign	Het
Washc4	T	A	10: 83,579,521	F792I	probably damaging	Het
Wdhd1	G	A	14: 47,258,584	H608Y	probably benign	Het
Wdr48	T	A	9: 119,902,404	I56K	probably damaging	Het
Xpo4	T	C	14: 57,629,503	D194G	probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp821	T	A	8: 109,709,533		probably null	Het
Zswim8	A	G	14: 20,719,457	Y1237C	probably damaging	Het

Other mutations in Lyn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01752:Lyn	APN	4	3743286	missense	probably benign
IGL02744:Lyn	APN	4	3738808	missense	probably benign	0.00
IGL02860:Lyn	APN	4	3745594	missense	possibly damaging	0.77
IGL03328:Lyn	APN	4	3745327	missense	probably benign	0.01
IGL03370:Lyn	APN	4	3780931	missense	possibly damaging	0.81
bibb	UTSW	4	3783055	missense	probably damaging	1.00
butterhead	UTSW	4	3748765	missense	probably benign	0.11
Cress	UTSW	4	3789908	nonsense	probably null
Friede	UTSW	4	3789834	nonsense	probably null
Kohlrabi	UTSW	4	3783089	missense	possibly damaging	0.74
lechuga	UTSW	4	3783050	missense	probably damaging	1.00
Lemon	UTSW	4	3746768	missense	probably damaging	1.00
Pacific	UTSW	4	3745330	missense	probably damaging	1.00
water	UTSW	4	3748787	missense	possibly damaging	0.93
R0079:Lyn	UTSW	4	3746768	missense	probably damaging	1.00
R0089:Lyn	UTSW	4	3748768	missense	probably benign	0.23
R0582:Lyn	UTSW	4	3743296	missense	probably damaging	1.00
R0747:Lyn	UTSW	4	3745638	splice site	probably benign
R1460:Lyn	UTSW	4	3789908	nonsense	probably null
R1615:Lyn	UTSW	4	3748765	missense	probably benign	0.11
R1654:Lyn	UTSW	4	3789912	missense	probably damaging	0.99
R1703:Lyn	UTSW	4	3738867	splice site	probably null
R2301:Lyn	UTSW	4	3780959	missense	probably damaging	1.00
R2512:Lyn	UTSW	4	3745542	missense	probably benign	0.01
R3418:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3419:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3701:Lyn	UTSW	4	3742455	missense	probably benign
R3702:Lyn	UTSW	4	3742455	missense	probably benign
R3736:Lyn	UTSW	4	3745330	missense	probably damaging	1.00
R4350:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4351:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4352:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4649:Lyn	UTSW	4	3738850	missense	probably benign
R5738:Lyn	UTSW	4	3782987	missense	probably damaging	1.00
R5875:Lyn	UTSW	4	3745631	splice site	probably null
R6375:Lyn	UTSW	4	3745527	missense	probably damaging	1.00
R7029:Lyn	UTSW	4	3782996	missense	probably damaging	0.98
R7621:Lyn	UTSW	4	3789834	nonsense	probably null
R7726:Lyn	UTSW	4	3756428	nonsense	probably null
R7940:Lyn	UTSW	4	3783089	missense	possibly damaging	0.74
R8169:Lyn	UTSW	4	3783050	missense	probably damaging	1.00
R8341:Lyn	UTSW	4	3743304	critical splice donor site	probably null
R8782:Lyn	UTSW	4	3783055	missense	probably damaging	1.00
R9056:Lyn	UTSW	4	3780925	missense	possibly damaging	0.89
R9353:Lyn	UTSW	4	3746804	missense	possibly damaging	0.71
R9567:Lyn	UTSW	4	3746757	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCAGCAAGCTTTCTTACCTAG -3'
(R):5'- CCACATCTGATGCAGCACTG -3'

Sequencing Primer
(F):5'- TGGAGAAGGCATGCATCA -3'
(R):5'- TGCAGCACTGAGCAAGCATC -3'

Posted On

2014-11-12