Incidental Mutation 'R2421:Zfp644'
ID 249280
Institutional Source Beutler Lab
Gene Symbol Zfp644
Ensembl Gene ENSMUSG00000049606
Gene Name zinc finger protein 644
Synonyms BM-005, Zep-2, D5Ertd689e, 1110068L01Rik
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 106764605-106844696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106785110 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 479 (M479T)
Ref Sequence ENSEMBL: ENSMUSP00000108316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698] [ENSMUST00000122980] [ENSMUST00000124263] [ENSMUST00000127434] [ENSMUST00000135108] [ENSMUST00000137285] [ENSMUST00000155495]
AlphaFold E9QA22
Predicted Effect possibly damaging
Transcript: ENSMUST00000045466
AA Change: M479T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: M479T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112695
SMART Domains Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Blast:ZnF_C2H2 39 65 2e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112696
AA Change: M479T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: M479T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 767 783 N/A INTRINSIC
low complexity region 802 819 N/A INTRINSIC
ZnF_C2H2 959 981 1.07e0 SMART
ZnF_C2H2 1034 1056 1.43e-1 SMART
low complexity region 1230 1243 N/A INTRINSIC
ZnF_C2H2 1257 1283 5.4e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112698
AA Change: M479T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: M479T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122980
Predicted Effect probably benign
Transcript: ENSMUST00000124263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125895
Predicted Effect probably benign
Transcript: ENSMUST00000127434
AA Change: M479T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122421
Gene: ENSMUSG00000049606
AA Change: M479T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149128
Predicted Effect probably benign
Transcript: ENSMUST00000137285
Predicted Effect probably benign
Transcript: ENSMUST00000155495
Meta Mutation Damage Score 0.1047 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Zfp644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Zfp644 APN 5 106,786,503 (GRCm39) critical splice acceptor site probably null
IGL01654:Zfp644 APN 5 106,783,796 (GRCm39) missense probably damaging 1.00
IGL01967:Zfp644 APN 5 106,786,109 (GRCm39) missense probably damaging 1.00
IGL02132:Zfp644 APN 5 106,783,760 (GRCm39) missense probably benign 0.22
IGL02164:Zfp644 APN 5 106,785,965 (GRCm39) missense probably benign 0.01
IGL02303:Zfp644 APN 5 106,785,180 (GRCm39) missense probably damaging 1.00
IGL03091:Zfp644 APN 5 106,784,724 (GRCm39) missense probably damaging 1.00
IGL03102:Zfp644 APN 5 106,785,134 (GRCm39) missense probably damaging 0.99
IGL03298:Zfp644 APN 5 106,782,967 (GRCm39) missense possibly damaging 0.93
PIT4466001:Zfp644 UTSW 5 106,784,343 (GRCm39) missense probably damaging 0.99
R0012:Zfp644 UTSW 5 106,782,909 (GRCm39) missense probably benign 0.11
R0012:Zfp644 UTSW 5 106,782,909 (GRCm39) missense probably benign 0.11
R0038:Zfp644 UTSW 5 106,782,909 (GRCm39) missense probably benign 0.11
R0038:Zfp644 UTSW 5 106,782,909 (GRCm39) missense probably benign 0.11
R0058:Zfp644 UTSW 5 106,784,869 (GRCm39) missense possibly damaging 0.69
R0058:Zfp644 UTSW 5 106,784,869 (GRCm39) missense possibly damaging 0.69
R0178:Zfp644 UTSW 5 106,784,771 (GRCm39) missense probably damaging 1.00
R0497:Zfp644 UTSW 5 106,786,199 (GRCm39) missense probably damaging 0.99
R1302:Zfp644 UTSW 5 106,782,765 (GRCm39) missense probably damaging 1.00
R1337:Zfp644 UTSW 5 106,785,420 (GRCm39) missense probably damaging 0.99
R1400:Zfp644 UTSW 5 106,785,336 (GRCm39) splice site probably null
R1597:Zfp644 UTSW 5 106,786,199 (GRCm39) missense probably damaging 0.99
R1911:Zfp644 UTSW 5 106,783,137 (GRCm39) missense possibly damaging 0.95
R2021:Zfp644 UTSW 5 106,783,548 (GRCm39) missense possibly damaging 0.84
R2196:Zfp644 UTSW 5 106,786,469 (GRCm39) start codon destroyed probably null 0.02
R2256:Zfp644 UTSW 5 106,783,711 (GRCm39) missense probably damaging 1.00
R2311:Zfp644 UTSW 5 106,782,822 (GRCm39) missense probably benign 0.21
R2420:Zfp644 UTSW 5 106,785,110 (GRCm39) missense possibly damaging 0.95
R2422:Zfp644 UTSW 5 106,785,110 (GRCm39) missense possibly damaging 0.95
R3752:Zfp644 UTSW 5 106,784,249 (GRCm39) missense probably benign
R4207:Zfp644 UTSW 5 106,766,142 (GRCm39) missense probably damaging 1.00
R4285:Zfp644 UTSW 5 106,782,984 (GRCm39) missense probably damaging 1.00
R4874:Zfp644 UTSW 5 106,783,279 (GRCm39) missense probably damaging 1.00
R4961:Zfp644 UTSW 5 106,766,081 (GRCm39) utr 3 prime probably benign
R4984:Zfp644 UTSW 5 106,784,783 (GRCm39) missense possibly damaging 0.96
R5007:Zfp644 UTSW 5 106,783,867 (GRCm39) missense probably benign
R5358:Zfp644 UTSW 5 106,783,541 (GRCm39) missense probably damaging 1.00
R5382:Zfp644 UTSW 5 106,782,735 (GRCm39) missense possibly damaging 0.88
R5416:Zfp644 UTSW 5 106,766,294 (GRCm39) splice site silent
R5641:Zfp644 UTSW 5 106,767,461 (GRCm39) missense probably damaging 1.00
R5656:Zfp644 UTSW 5 106,785,848 (GRCm39) missense probably benign 0.12
R5732:Zfp644 UTSW 5 106,784,989 (GRCm39) missense probably damaging 1.00
R6039:Zfp644 UTSW 5 106,783,291 (GRCm39) missense possibly damaging 0.93
R6039:Zfp644 UTSW 5 106,783,291 (GRCm39) missense possibly damaging 0.93
R6306:Zfp644 UTSW 5 106,785,990 (GRCm39) missense probably damaging 0.99
R6317:Zfp644 UTSW 5 106,783,711 (GRCm39) missense probably damaging 1.00
R6354:Zfp644 UTSW 5 106,784,619 (GRCm39) missense probably benign 0.23
R6886:Zfp644 UTSW 5 106,785,777 (GRCm39) missense possibly damaging 0.53
R7223:Zfp644 UTSW 5 106,785,448 (GRCm39) nonsense probably null
R7326:Zfp644 UTSW 5 106,786,143 (GRCm39) missense probably benign 0.12
R7450:Zfp644 UTSW 5 106,786,392 (GRCm39) missense probably benign 0.00
R8095:Zfp644 UTSW 5 106,766,280 (GRCm39) missense possibly damaging 0.93
R8710:Zfp644 UTSW 5 106,782,997 (GRCm39) missense probably damaging 0.99
R8822:Zfp644 UTSW 5 106,783,087 (GRCm39) missense possibly damaging 0.93
R8936:Zfp644 UTSW 5 106,783,503 (GRCm39) missense probably damaging 1.00
R8975:Zfp644 UTSW 5 106,785,467 (GRCm39) missense probably benign
R9056:Zfp644 UTSW 5 106,783,944 (GRCm39) nonsense probably null
R9192:Zfp644 UTSW 5 106,785,829 (GRCm39) missense probably benign
R9250:Zfp644 UTSW 5 106,784,699 (GRCm39) missense probably damaging 0.99
R9287:Zfp644 UTSW 5 106,785,774 (GRCm39) missense possibly damaging 0.94
R9313:Zfp644 UTSW 5 106,784,324 (GRCm39) missense probably benign 0.25
R9600:Zfp644 UTSW 5 106,783,909 (GRCm39) missense probably benign
R9766:Zfp644 UTSW 5 106,784,691 (GRCm39) missense probably damaging 1.00
R9789:Zfp644 UTSW 5 106,786,131 (GRCm39) missense possibly damaging 0.91
X0011:Zfp644 UTSW 5 106,766,293 (GRCm39) missense probably damaging 1.00
Z1176:Zfp644 UTSW 5 106,783,610 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTCCGTCACTGCCATGAAG -3'
(R):5'- GAAGAGCCATCATTCTACCCCTG -3'

Sequencing Primer
(F):5'- GTCACTGCCATGAAGTTACACTC -3'
(R):5'- CCCTGTACAAAGTGCAATGTG -3'
Posted On 2014-11-12