Incidental Mutation 'R2421:Atxn2'
ID 249283
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.783) question?
Stock # R2421 (G1)
Quality Score 185
Status Validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 121940142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327] [ENSMUST00000162327]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160093
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161872
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199451
Meta Mutation Damage Score 0.9709 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCTTACCTGAAGCAAGTG -3'
(R):5'- GAAGTGAGTTAGGTTCCACTGG -3'

Sequencing Primer
(F):5'- CTTACCTGAAGCAAGTGGAGCAATG -3'
(R):5'- CCTTACCTGAGACTGATAATGCGG -3'
Posted On 2014-11-12