Mutagenetix > Incidental Mutation

Incidental Mutation 'R2421:Arhgef12'

249292

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

040383-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R2421 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43001006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 519 (C519S)

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

AlphaFold

Q8R4H2

Predicted Effect

probably damaging
Transcript: ENSMUST00000072767
AA Change: C518S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: C518S

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165665
AA Change: C519S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: C519S

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Meta Mutation Damage Score

0.3540

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	C	5: 5,455,912	Y123C	probably benign	Het
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
Abraxas1	C	T	5: 100,812,174	R104H	possibly damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adcy10	T	A	1: 165,558,597	L1118Q	probably damaging	Het
Adgre4	A	G	17: 55,778,872	E57G	probably benign	Het
Alpk2	T	C	18: 65,306,616	S1036G	probably benign	Het
Ank3	T	C	10: 69,982,204		probably benign	Het
Ankfy1	T	A	11: 72,755,896		probably benign	Het
Antxrl	A	G	14: 34,071,689		probably benign	Het
Apaf1	A	T	10: 91,020,723	V874D	probably damaging	Het
Arhgap39	T	A	15: 76,725,146	T1025S	probably damaging	Het
Aspm	G	A	1: 139,488,487	V1512M	possibly damaging	Het
Atp13a3	T	C	16: 30,349,825	T449A	probably benign	Het
Atxn2	A	T	5: 121,802,079		probably null	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Camk2d	A	G	3: 126,780,415	D157G	probably damaging	Het
Ccdc122	T	C	14: 77,091,663		probably benign	Het
Ccdc137	G	A	11: 120,462,264		probably null	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Col4a3	G	A	1: 82,670,275		probably benign	Het
Coq10b	G	A	1: 55,052,977	A35T	probably benign	Het
Creb3l3	T	C	10: 81,091,818	I47V	probably benign	Het
Csgalnact1	A	T	8: 68,461,508	I15N	probably benign	Het
Dcp1b	A	G	6: 119,215,266	Q381R	probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Dnal1	C	T	12: 84,136,706	Q80*	probably null	Het
Dtd2	A	G	12: 51,999,855	V67A	probably benign	Het
Gart	A	G	16: 91,643,040		probably null	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm6327	T	C	16: 12,760,094		noncoding transcript	Het
Gm8674	T	C	13: 49,900,663		noncoding transcript	Het
Gpr107	G	A	2: 31,185,529	G351S	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Krt13	A	T	11: 100,120,051	L159Q	probably benign	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lenep	G	A	3: 89,402,574		probably null	Het
Lrp1b	T	C	2: 40,882,133		probably benign	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Lyn	C	T	4: 3,748,787	A255V	possibly damaging	Het
Mdn1	T	A	4: 32,723,621	I2519K	probably damaging	Het
Mmaa	T	A	8: 79,281,432	R59W	probably damaging	Het
Ms4a4b	A	G	19: 11,454,697	I61V	possibly damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Olfr1219	T	C	2: 89,074,992	Y33C	possibly damaging	Het
Olfr175-ps1	T	C	16: 58,824,346	D121G	probably damaging	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr211	T	A	6: 116,493,713	C35S	probably benign	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pef1	C	A	4: 130,127,317	C221*	probably null	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Pnliprp1	T	A	19: 58,744,085	I460N	probably benign	Het
Ppfia4	T	C	1: 134,327,400	N239S	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Prlr	T	A	15: 10,319,257	W91R	probably damaging	Het
Psmd2	T	A	16: 20,660,106		probably null	Het
Ptprt	T	A	2: 162,278,040		probably benign	Het
Rbm12b2	T	C	4: 12,095,127	F662S	possibly damaging	Het
Rgs6	C	A	12: 83,116,283	T421K	possibly damaging	Het
Ryr2	T	G	13: 11,591,237	Q4486H	probably damaging	Het
Scn7a	A	T	2: 66,726,302		probably benign	Het
Smc1a	A	G	X: 152,047,975		probably benign	Het
Synrg	A	G	11: 84,009,224	E674G	probably damaging	Het
Syt9	G	A	7: 107,436,781	R335K	probably benign	Het
Taar7a	T	C	10: 23,992,517	N322S	probably damaging	Het
Tfb2m	C	A	1: 179,533,666	W252C	possibly damaging	Het
Tmub2	T	A	11: 102,287,755	D161E	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw1	A	T	5: 130,269,260	H214L	probably damaging	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vangl2	T	C	1: 172,007,959	Y382C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Vps13a	T	G	19: 16,759,671	I101L	probably benign	Het
Washc4	T	A	10: 83,579,521	F792I	probably damaging	Het
Wdhd1	G	A	14: 47,258,584	H608Y	probably benign	Het
Wdr48	T	A	9: 119,902,404	I56K	probably damaging	Het
Xpo4	T	C	14: 57,629,503	D194G	probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp821	T	A	8: 109,709,533		probably null	Het
Zswim8	A	G	14: 20,719,457	Y1237C	probably damaging	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43020624	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42982000	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42990055	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43022841	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42972267	missense	probably benign
IGL02135:Arhgef12	APN	9	42972165	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43001452	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42982043	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42992563	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43005623	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43005904	nonsense	probably null
IGL02803:Arhgef12	APN	9	42972028	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43000972	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43015920	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42999077	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43026228	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42974570	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42992533	splice site	probably benign
IGL03398:Arhgef12	APN	9	42978226	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42978233	missense	probably damaging	1.00
R0143:Arhgef12	UTSW	9	43005594	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42972004	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0426:Arhgef12	UTSW	9	42970990	splice site	probably null
R0658:Arhgef12	UTSW	9	42981985	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42993028	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42972381	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43044256	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43005870	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43027220	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42992578	splice site	probably benign
R1458:Arhgef12	UTSW	9	42988998	missense	probably damaging	0.98
R1654:Arhgef12	UTSW	9	42997660	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43020717	makesense	probably null
R1773:Arhgef12	UTSW	9	43005542	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43005856	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42979472	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43005871	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42972274	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43018349	nonsense	probably null
R4327:Arhgef12	UTSW	9	42975229	nonsense	probably null
R4462:Arhgef12	UTSW	9	42981982	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42977662	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42981970	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42972153	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43020696	missense	probably benign
R4840:Arhgef12	UTSW	9	42975068	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42993065	nonsense	probably null
R5176:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R5426:Arhgef12	UTSW	9	42986584	missense	probably damaging	1.00
R5579:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R5838:Arhgef12	UTSW	9	43005608	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42988965	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42972207	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43015953	missense	probably benign
R7252:Arhgef12	UTSW	9	43015909	missense	probably benign	0.17
R7470:Arhgef12	UTSW	9	43040552	missense	probably damaging	1.00
R7658:Arhgef12	UTSW	9	42992536	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43027271	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42971299	nonsense	probably null
R8074:Arhgef12	UTSW	9	42971103	nonsense	probably null
R8155:Arhgef12	UTSW	9	43042662	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42971058	missense	probably benign
R8407:Arhgef12	UTSW	9	43026179	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42997648	missense	possibly damaging	0.95
R9116:Arhgef12	UTSW	9	42981945	splice site	probably benign
R9127:Arhgef12	UTSW	9	42974574	missense	possibly damaging	0.94
R9602:Arhgef12	UTSW	9	42984380	missense	probably damaging	1.00
R9665:Arhgef12	UTSW	9	43018354	missense	possibly damaging	0.89
R9733:Arhgef12	UTSW	9	42989998	nonsense	probably null
R9735:Arhgef12	UTSW	9	42971103	nonsense	probably null
R9760:Arhgef12	UTSW	9	42992022	missense	probably damaging	1.00
RF020:Arhgef12	UTSW	9	42989989	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42971072	missense	probably benign	0.00
Z1186:Arhgef12	UTSW	9	43000015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCAGCGCTTATCACTGAC -3'
(R):5'- AGGGCTGTCTAGACACCTAG -3'

Sequencing Primer
(F):5'- AGCGCTTATCACTGACTACAAG -3'
(R):5'- CACCTAGAGGGAGATAGTTTGCTCTC -3'

Posted On

2014-11-12