Incidental Mutation 'R2421:Unc13c'
ID249293
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission 040383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2421 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73931547 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 674 (Y674C)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: Y674C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: Y674C

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: Y674C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: Y674C

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adcy10 T A 1: 165,558,597 L1118Q probably damaging Het
Adgre4 A G 17: 55,778,872 E57G probably benign Het
Alpk2 T C 18: 65,306,616 S1036G probably benign Het
Ank3 T C 10: 69,982,204 probably benign Het
Ankfy1 T A 11: 72,755,896 probably benign Het
Antxrl A G 14: 34,071,689 probably benign Het
Apaf1 A T 10: 91,020,723 V874D probably damaging Het
Arhgap39 T A 15: 76,725,146 T1025S probably damaging Het
Arhgef12 A T 9: 43,001,006 C519S probably damaging Het
Aspm G A 1: 139,488,487 V1512M possibly damaging Het
Atp13a3 T C 16: 30,349,825 T449A probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Camk2d A G 3: 126,780,415 D157G probably damaging Het
Ccdc122 T C 14: 77,091,663 probably benign Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Col4a3 G A 1: 82,670,275 probably benign Het
Coq10b G A 1: 55,052,977 A35T probably benign Het
Creb3l3 T C 10: 81,091,818 I47V probably benign Het
Csgalnact1 A T 8: 68,461,508 I15N probably benign Het
Dcp1b A G 6: 119,215,266 Q381R probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Dnal1 C T 12: 84,136,706 Q80* probably null Het
Dtd2 A G 12: 51,999,855 V67A probably benign Het
Gart A G 16: 91,643,040 probably null Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm6327 T C 16: 12,760,094 noncoding transcript Het
Gm8674 T C 13: 49,900,663 noncoding transcript Het
Gpr107 G A 2: 31,185,529 G351S probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lenep G A 3: 89,402,574 probably null Het
Lrp1b T C 2: 40,882,133 probably benign Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Lyn C T 4: 3,748,787 A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 I2519K probably damaging Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Ms4a4b A G 19: 11,454,697 I61V possibly damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr175-ps1 T C 16: 58,824,346 D121G probably damaging Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr211 T A 6: 116,493,713 C35S probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pef1 C A 4: 130,127,317 C221* probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Pnliprp1 T A 19: 58,744,085 I460N probably benign Het
Ppfia4 T C 1: 134,327,400 N239S probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Prlr T A 15: 10,319,257 W91R probably damaging Het
Psmd2 T A 16: 20,660,106 probably null Het
Ptprt T A 2: 162,278,040 probably benign Het
Rbm12b2 T C 4: 12,095,127 F662S possibly damaging Het
Rgs6 C A 12: 83,116,283 T421K possibly damaging Het
Ryr2 T G 13: 11,591,237 Q4486H probably damaging Het
Scn7a A T 2: 66,726,302 probably benign Het
Smc1a A G X: 152,047,975 probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Syt9 G A 7: 107,436,781 R335K probably benign Het
Taar7a T C 10: 23,992,517 N322S probably damaging Het
Tfb2m C A 1: 179,533,666 W252C possibly damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw1 A T 5: 130,269,260 H214L probably damaging Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Vangl2 T C 1: 172,007,959 Y382C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Vps13a T G 19: 16,759,671 I101L probably benign Het
Washc4 T A 10: 83,579,521 F792I probably damaging Het
Wdhd1 G A 14: 47,258,584 H608Y probably benign Het
Wdr48 T A 9: 119,902,404 I56K probably damaging Het
Xpo4 T C 14: 57,629,503 D194G probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp821 T A 8: 109,709,533 probably null Het
Zswim8 A G 14: 20,719,457 Y1237C probably damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGTCGTACTGGCCAAC -3'
(R):5'- AGACTATTCCAGCAGTGCCAG -3'

Sequencing Primer
(F):5'- TCGTACTGGCCAACCCACTG -3'
(R):5'- CCAGGGCAGGCTGAAATTG -3'
Posted On2014-11-12