Incidental Mutation 'R2421:Wdr48'
ID 249294
Institutional Source Beutler Lab
Gene Symbol Wdr48
Ensembl Gene ENSMUSG00000032512
Gene Name WD repeat domain 48
Synonyms Uaf1, 8430408H12Rik
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119723961-119755652 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119731470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 56 (I56K)
Ref Sequence ENSEMBL: ENSMUSP00000150321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215307] [ENSMUST00000217472]
AlphaFold Q8BH57
Predicted Effect probably damaging
Transcript: ENSMUST00000036561
AA Change: I56K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512
AA Change: I56K

DomainStartEndE-ValueType
WD40 14 58 2.88e-1 SMART
WD40 64 103 2.1e-7 SMART
WD40 106 145 1.37e-6 SMART
WD40 157 196 5.39e-5 SMART
WD40 199 238 1.62e-8 SMART
WD40 241 280 4.62e-4 SMART
WD40 350 388 8.84e1 SMART
low complexity region 460 471 N/A INTRINSIC
Pfam:DUF3337 509 673 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214716
Predicted Effect probably damaging
Transcript: ENSMUST00000215307
AA Change: I56K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217472
AA Change: I56K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.3873 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to interact with ubiquitin specific peptidase 1 (USP1), activating the deubiquitinating activity of USP1 and allowing it to remove the ubiquitin moiety from monoubiquitinated FANCD2. FANCD2 is ubiquitinated in response to DNA damage. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10.5 with reduced embryonic growth. Mice heterozygous for this allele exhibit reduced weight at birth, skeletal defects and reduced female and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Wdr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Wdr48 APN 9 119,734,456 (GRCm39) missense probably damaging 1.00
IGL02005:Wdr48 APN 9 119,734,455 (GRCm39) missense probably damaging 1.00
IGL02097:Wdr48 APN 9 119,753,329 (GRCm39) missense probably damaging 1.00
IGL02217:Wdr48 APN 9 119,738,601 (GRCm39) missense probably benign 0.01
IGL02416:Wdr48 APN 9 119,753,826 (GRCm39) missense probably damaging 0.98
IGL03198:Wdr48 APN 9 119,741,479 (GRCm39) missense probably benign 0.01
R0005:Wdr48 UTSW 9 119,738,500 (GRCm39) missense probably benign 0.01
R0109:Wdr48 UTSW 9 119,747,634 (GRCm39) splice site probably benign
R1753:Wdr48 UTSW 9 119,753,313 (GRCm39) nonsense probably null
R1829:Wdr48 UTSW 9 119,733,396 (GRCm39) missense probably benign 0.03
R1837:Wdr48 UTSW 9 119,734,482 (GRCm39) missense probably damaging 0.99
R1881:Wdr48 UTSW 9 119,738,606 (GRCm39) missense probably benign 0.00
R1916:Wdr48 UTSW 9 119,741,483 (GRCm39) missense probably benign 0.01
R2039:Wdr48 UTSW 9 119,738,453 (GRCm39) missense probably damaging 1.00
R3031:Wdr48 UTSW 9 119,753,176 (GRCm39) missense probably benign 0.02
R3719:Wdr48 UTSW 9 119,736,197 (GRCm39) missense probably damaging 1.00
R6014:Wdr48 UTSW 9 119,753,775 (GRCm39) missense probably damaging 1.00
R6054:Wdr48 UTSW 9 119,736,843 (GRCm39) missense probably damaging 1.00
R6182:Wdr48 UTSW 9 119,753,832 (GRCm39) missense probably damaging 1.00
R6285:Wdr48 UTSW 9 119,749,676 (GRCm39) missense probably damaging 1.00
R6434:Wdr48 UTSW 9 119,745,879 (GRCm39) missense possibly damaging 0.94
R7167:Wdr48 UTSW 9 119,736,855 (GRCm39) critical splice donor site probably null
R7282:Wdr48 UTSW 9 119,740,147 (GRCm39) missense probably damaging 1.00
R7567:Wdr48 UTSW 9 119,745,894 (GRCm39) missense possibly damaging 0.66
R7912:Wdr48 UTSW 9 119,733,405 (GRCm39) missense probably damaging 1.00
R8373:Wdr48 UTSW 9 119,734,560 (GRCm39) missense probably damaging 1.00
R8932:Wdr48 UTSW 9 119,740,142 (GRCm39) missense probably damaging 1.00
R9183:Wdr48 UTSW 9 119,749,730 (GRCm39) missense possibly damaging 0.59
R9390:Wdr48 UTSW 9 119,746,245 (GRCm39) missense probably benign
R9567:Wdr48 UTSW 9 119,741,454 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCACTAGAAGGCTACAC -3'
(R):5'- TTATGGCAGCCCTGAGTTAAG -3'

Sequencing Primer
(F):5'- ACACCTCACCATGGCTTG -3'
(R):5'- AAACTTTCCTGGAGGCGTTC -3'
Posted On 2014-11-12