Incidental Mutation 'R2421:Ank3'
ID 249297
Institutional Source Beutler Lab
Gene Symbol Ank3
Ensembl Gene ENSMUSG00000069601
Gene Name ankyrin 3, epithelial
Synonyms AnkG, Ankyrin-3, Ank-3, Ankyrin-G, 2900054D09Rik
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.852) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 69234608-69863266 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 69818034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047061] [ENSMUST00000054167] [ENSMUST00000092431] [ENSMUST00000092432] [ENSMUST00000092433] [ENSMUST00000092434] [ENSMUST00000181974] [ENSMUST00000182029] [ENSMUST00000182155] [ENSMUST00000182207] [ENSMUST00000182439] [ENSMUST00000182692] [ENSMUST00000182972] [ENSMUST00000182884] [ENSMUST00000182992] [ENSMUST00000182269] [ENSMUST00000183169] [ENSMUST00000183261] [ENSMUST00000182795] [ENSMUST00000183074] [ENSMUST00000182437] [ENSMUST00000183148] [ENSMUST00000218680]
AlphaFold G5E8K5
Predicted Effect probably benign
Transcript: ENSMUST00000047061
SMART Domains Protein: ENSMUSP00000045834
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054167
SMART Domains Protein: ENSMUSP00000061698
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1760 1780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092431
SMART Domains Protein: ENSMUSP00000090087
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 885 902 N/A INTRINSIC
ZU5 962 1066 2.27e-58 SMART
DEATH 1447 1541 5.8e-33 SMART
low complexity region 1778 1798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092432
SMART Domains Protein: ENSMUSP00000090088
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 888 905 N/A INTRINSIC
ZU5 965 1069 2.27e-58 SMART
DEATH 1450 1544 5.8e-33 SMART
low complexity region 1781 1801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092433
SMART Domains Protein: ENSMUSP00000090089
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092434
SMART Domains Protein: ENSMUSP00000090090
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 6.5e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7.1e-9 SMART
ANK 155 183 4.2e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.4e-7 SMART
ANK 250 279 3.8e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.3e-7 SMART
ANK 349 378 9.9e-8 SMART
ANK 382 411 2.5e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 6e-8 SMART
ANK 481 510 7.4e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.2e-8 SMART
ANK 580 609 3e-6 SMART
ANK 613 642 5.4e-8 SMART
ANK 646 675 3.3e-6 SMART
ANK 679 708 4.3e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 9.1e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.8e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181974
SMART Domains Protein: ENSMUSP00000138285
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 736 756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182029
SMART Domains Protein: ENSMUSP00000138337
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182155
SMART Domains Protein: ENSMUSP00000138347
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1564 1584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182474
Predicted Effect probably benign
Transcript: ENSMUST00000182207
SMART Domains Protein: ENSMUSP00000138531
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
DEATH 59 153 5.8e-33 SMART
low complexity region 297 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182439
SMART Domains Protein: ENSMUSP00000138356
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182606
Predicted Effect probably benign
Transcript: ENSMUST00000182692
SMART Domains Protein: ENSMUSP00000138623
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 839 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182972
SMART Domains Protein: ENSMUSP00000138481
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 4 33 1.43e-5 SMART
low complexity region 61 72 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
ZU5 203 307 2.27e-58 SMART
DEATH 688 782 5.8e-33 SMART
low complexity region 1019 1039 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182884
SMART Domains Protein: ENSMUSP00000138326
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 6.4e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7e-9 SMART
ANK 155 183 4.1e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.2e-7 SMART
ANK 250 279 3.7e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.2e-7 SMART
ANK 349 378 9.7e-8 SMART
ANK 382 411 2.4e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 5.9e-8 SMART
ANK 481 510 7.3e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.1e-8 SMART
ANK 580 609 2.9e-6 SMART
ANK 613 642 5.3e-8 SMART
ANK 646 675 3.2e-6 SMART
ANK 679 708 4.2e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 8.9e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.7e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182992
SMART Domains Protein: ENSMUSP00000138686
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
coiled coil region 4 38 N/A INTRINSIC
ANK 73 102 1.01e-5 SMART
ANK 106 135 1.66e-6 SMART
ANK 139 168 1.1e-6 SMART
ANK 172 200 6.51e0 SMART
ANK 201 230 2.6e1 SMART
ANK 242 271 1.31e-4 SMART
ANK 275 304 5.88e-7 SMART
ANK 308 337 3.23e-4 SMART
ANK 341 370 8.07e-5 SMART
ANK 374 403 1.53e-5 SMART
ANK 407 436 3.88e-7 SMART
ANK 440 469 1.99e-4 SMART
ANK 473 502 9.41e-6 SMART
ANK 506 535 1.14e-4 SMART
ANK 539 568 2.94e-7 SMART
ANK 572 601 3.33e-6 SMART
ANK 605 634 4.56e-4 SMART
ANK 638 667 8.19e-6 SMART
ANK 671 700 5.24e-4 SMART
ANK 704 733 6.46e-4 SMART
ANK 737 766 6.21e-6 SMART
ANK 770 799 1.43e-5 SMART
low complexity region 827 838 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
ZU5 990 1094 2.27e-58 SMART
low complexity region 1515 1536 N/A INTRINSIC
low complexity region 1745 1762 N/A INTRINSIC
low complexity region 1805 1827 N/A INTRINSIC
low complexity region 1876 1897 N/A INTRINSIC
low complexity region 1969 1984 N/A INTRINSIC
DEATH 2325 2419 7.66e-33 SMART
low complexity region 2460 2480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182687
Predicted Effect probably benign
Transcript: ENSMUST00000182269
SMART Domains Protein: ENSMUSP00000138123
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 886 895 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 935 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183169
SMART Domains Protein: ENSMUSP00000138348
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1551 1571 N/A INTRINSIC
low complexity region 1715 1724 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183261
SMART Domains Protein: ENSMUSP00000138095
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1082 1091 N/A INTRINSIC
low complexity region 1093 1105 N/A INTRINSIC
low complexity region 1131 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182795
SMART Domains Protein: ENSMUSP00000138413
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 111 215 2.27e-58 SMART
DEATH 584 678 7.66e-33 SMART
low complexity region 719 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183074
SMART Domains Protein: ENSMUSP00000138671
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1065 1074 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1114 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182437
SMART Domains Protein: ENSMUSP00000138586
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 869 878 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 918 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183148
SMART Domains Protein: ENSMUSP00000138770
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1747 1767 N/A INTRINSIC
low complexity region 1893 1902 N/A INTRINSIC
low complexity region 1904 1916 N/A INTRINSIC
low complexity region 1942 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186247
Predicted Effect probably benign
Transcript: ENSMUST00000218680
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: This gene encodes a member of the ankyrin protein family. Ankyrins link integral membrane proteins to the spectrin-based cytoskeleton. Ankyrin family members share a protein structure which includes three independently folded domains: the N-terminal ankyrin repeat domain, the central spectrin-binding domain, and the C-terminal rod domain. This ankyrin functions as the major ankyrin in the kidney and may play a role in the polarized distribution of many integral membrane proteins to specific subcellular sites. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a mutation that selectively ablates gene expression in brain exhibit progressive ataxia, tremors, and a substantially reduced cerebellum deficient in Purkinje cells. Mutants are poor breeders and die by 4-6 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Ank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ank3 APN 10 69,818,035 (GRCm39) splice site probably benign
IGL00578:Ank3 APN 10 69,838,224 (GRCm39) missense possibly damaging 0.95
IGL00851:Ank3 APN 10 69,710,663 (GRCm39) missense probably damaging 0.99
IGL01067:Ank3 APN 10 69,686,026 (GRCm39) missense probably damaging 1.00
IGL01483:Ank3 APN 10 69,710,639 (GRCm39) missense probably damaging 1.00
IGL01549:Ank3 APN 10 69,768,250 (GRCm39) missense probably damaging 1.00
IGL01576:Ank3 APN 10 69,816,121 (GRCm39) missense probably damaging 1.00
IGL01601:Ank3 APN 10 69,840,555 (GRCm39) missense possibly damaging 0.87
IGL02047:Ank3 APN 10 69,728,324 (GRCm39) missense possibly damaging 0.94
IGL02088:Ank3 APN 10 69,835,203 (GRCm39) missense probably damaging 1.00
IGL02159:Ank3 APN 10 69,644,722 (GRCm39) missense probably damaging 1.00
IGL02249:Ank3 APN 10 69,718,200 (GRCm39) missense probably damaging 1.00
IGL02942:Ank3 APN 10 69,809,707 (GRCm39) missense probably damaging 1.00
IGL02979:Ank3 APN 10 69,837,929 (GRCm39) missense probably benign 0.01
IGL03379:Ank3 APN 10 69,809,602 (GRCm39) missense probably damaging 1.00
PIT4495001:Ank3 UTSW 10 69,828,902 (GRCm39) missense
R0011:Ank3 UTSW 10 69,815,281 (GRCm39) splice site probably benign
R0011:Ank3 UTSW 10 69,815,281 (GRCm39) splice site probably benign
R0172:Ank3 UTSW 10 69,811,888 (GRCm39) missense probably damaging 1.00
R0315:Ank3 UTSW 10 69,838,347 (GRCm39) missense probably damaging 0.98
R0480:Ank3 UTSW 10 69,715,756 (GRCm39) missense probably damaging 0.96
R0485:Ank3 UTSW 10 69,718,374 (GRCm39) missense possibly damaging 0.89
R0511:Ank3 UTSW 10 69,718,198 (GRCm39) missense probably damaging 1.00
R1148:Ank3 UTSW 10 69,718,369 (GRCm39) missense probably damaging 1.00
R1148:Ank3 UTSW 10 69,718,369 (GRCm39) missense probably damaging 1.00
R1165:Ank3 UTSW 10 69,734,132 (GRCm39) missense possibly damaging 0.90
R1186:Ank3 UTSW 10 69,703,290 (GRCm39) missense probably damaging 1.00
R1257:Ank3 UTSW 10 69,710,665 (GRCm39) nonsense probably null
R1300:Ank3 UTSW 10 69,840,495 (GRCm39) missense probably benign 0.03
R1391:Ank3 UTSW 10 69,370,110 (GRCm39) missense possibly damaging 0.96
R1549:Ank3 UTSW 10 69,837,812 (GRCm39) missense probably benign 0.18
R1586:Ank3 UTSW 10 69,713,708 (GRCm39) missense probably damaging 0.98
R1619:Ank3 UTSW 10 69,715,805 (GRCm39) missense probably damaging 1.00
R1643:Ank3 UTSW 10 69,720,632 (GRCm39) missense probably benign 0.00
R1874:Ank3 UTSW 10 69,733,913 (GRCm39) missense probably damaging 1.00
R1884:Ank3 UTSW 10 69,851,422 (GRCm39) missense possibly damaging 0.53
R1901:Ank3 UTSW 10 69,658,167 (GRCm39) missense probably damaging 1.00
R1986:Ank3 UTSW 10 69,703,258 (GRCm39) missense probably damaging 1.00
R2051:Ank3 UTSW 10 69,733,920 (GRCm39) missense probably damaging 0.97
R2273:Ank3 UTSW 10 69,786,772 (GRCm39) splice site probably null
R2274:Ank3 UTSW 10 69,786,772 (GRCm39) splice site probably null
R2434:Ank3 UTSW 10 69,837,948 (GRCm39) missense probably damaging 1.00
R2969:Ank3 UTSW 10 69,830,225 (GRCm39) missense probably damaging 1.00
R3426:Ank3 UTSW 10 69,542,724 (GRCm39) missense probably benign
R3885:Ank3 UTSW 10 69,734,866 (GRCm39) missense probably damaging 1.00
R3936:Ank3 UTSW 10 69,715,819 (GRCm39) nonsense probably null
R4258:Ank3 UTSW 10 69,840,592 (GRCm39) missense probably benign 0.33
R4320:Ank3 UTSW 10 69,740,076 (GRCm39) missense possibly damaging 0.70
R4434:Ank3 UTSW 10 69,822,900 (GRCm39) missense probably damaging 0.99
R4435:Ank3 UTSW 10 69,822,900 (GRCm39) missense probably damaging 0.99
R4486:Ank3 UTSW 10 69,837,804 (GRCm39) missense possibly damaging 0.86
R4489:Ank3 UTSW 10 69,734,086 (GRCm39) missense probably damaging 1.00
R4492:Ank3 UTSW 10 69,644,755 (GRCm39) missense probably damaging 1.00
R4508:Ank3 UTSW 10 69,728,200 (GRCm39) missense probably damaging 1.00
R4561:Ank3 UTSW 10 69,837,848 (GRCm39) missense probably damaging 0.99
R4724:Ank3 UTSW 10 69,542,688 (GRCm39) missense probably benign
R4751:Ank3 UTSW 10 69,822,036 (GRCm39) missense probably benign 0.19
R4790:Ank3 UTSW 10 69,823,981 (GRCm39) nonsense probably null
R4795:Ank3 UTSW 10 69,694,095 (GRCm39) missense probably benign 0.36
R4921:Ank3 UTSW 10 69,837,939 (GRCm39) missense probably damaging 1.00
R4932:Ank3 UTSW 10 69,734,053 (GRCm39) splice site probably null
R4935:Ank3 UTSW 10 69,812,033 (GRCm39) missense probably damaging 0.99
R4946:Ank3 UTSW 10 69,733,947 (GRCm39) missense probably damaging 1.00
R5174:Ank3 UTSW 10 69,728,209 (GRCm39) missense probably damaging 0.99
R5208:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5248:Ank3 UTSW 10 69,822,938 (GRCm39) missense probably benign 0.00
R5255:Ank3 UTSW 10 69,721,030 (GRCm39) missense probably damaging 1.00
R5307:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5308:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5373:Ank3 UTSW 10 69,789,306 (GRCm39) splice site probably null
R5374:Ank3 UTSW 10 69,789,306 (GRCm39) splice site probably null
R5502:Ank3 UTSW 10 69,756,291 (GRCm39) missense probably benign 0.12
R5508:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5509:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5510:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5538:Ank3 UTSW 10 69,823,257 (GRCm39) missense probably damaging 1.00
R5664:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5665:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R5682:Ank3 UTSW 10 69,729,347 (GRCm39) missense probably damaging 1.00
R5834:Ank3 UTSW 10 69,658,087 (GRCm39) missense probably damaging 1.00
R5881:Ank3 UTSW 10 69,822,660 (GRCm39) missense probably benign 0.31
R5914:Ank3 UTSW 10 69,828,774 (GRCm39) intron probably benign
R5940:Ank3 UTSW 10 69,756,316 (GRCm39) missense probably benign 0.00
R5952:Ank3 UTSW 10 69,822,293 (GRCm39) missense probably benign 0.07
R5963:Ank3 UTSW 10 69,823,056 (GRCm39) nonsense probably null
R6075:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6076:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6077:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6081:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6092:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6118:Ank3 UTSW 10 69,830,231 (GRCm39) missense probably damaging 0.98
R6135:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6175:Ank3 UTSW 10 69,763,557 (GRCm39) missense probably damaging 1.00
R6248:Ank3 UTSW 10 69,809,680 (GRCm39) missense probably benign 0.10
R6249:Ank3 UTSW 10 69,658,906 (GRCm39) critical splice acceptor site probably null
R6273:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6274:Ank3 UTSW 10 69,838,395 (GRCm39) missense possibly damaging 0.91
R6290:Ank3 UTSW 10 69,827,198 (GRCm39) intron probably benign
R6298:Ank3 UTSW 10 69,686,006 (GRCm39) missense probably damaging 1.00
R6349:Ank3 UTSW 10 69,815,269 (GRCm39) missense probably damaging 1.00
R6366:Ank3 UTSW 10 69,835,188 (GRCm39) missense probably damaging 1.00
R6371:Ank3 UTSW 10 69,644,709 (GRCm39) missense probably damaging 1.00
R6459:Ank3 UTSW 10 69,827,577 (GRCm39) intron probably benign
R6489:Ank3 UTSW 10 69,827,459 (GRCm39) missense probably benign 0.00
R6491:Ank3 UTSW 10 69,827,459 (GRCm39) missense probably benign 0.00
R6499:Ank3 UTSW 10 69,827,574 (GRCm39) intron probably benign
R6520:Ank3 UTSW 10 69,824,217 (GRCm39) missense probably damaging 1.00
R6521:Ank3 UTSW 10 69,828,596 (GRCm39) intron probably benign
R6535:Ank3 UTSW 10 69,713,684 (GRCm39) missense probably damaging 1.00
R6548:Ank3 UTSW 10 69,728,240 (GRCm39) missense probably damaging 1.00
R6587:Ank3 UTSW 10 69,825,982 (GRCm39) intron probably benign
R6624:Ank3 UTSW 10 69,740,298 (GRCm39) missense possibly damaging 0.66
R6722:Ank3 UTSW 10 69,826,074 (GRCm39) intron probably benign
R6729:Ank3 UTSW 10 69,644,755 (GRCm39) missense probably damaging 1.00
R6731:Ank3 UTSW 10 69,849,858 (GRCm39) missense possibly damaging 0.70
R6742:Ank3 UTSW 10 69,827,412 (GRCm39) intron probably benign
R6788:Ank3 UTSW 10 69,840,553 (GRCm39) missense probably damaging 1.00
R6846:Ank3 UTSW 10 69,660,179 (GRCm39) missense probably damaging 1.00
R6933:Ank3 UTSW 10 69,740,042 (GRCm39) missense probably damaging 1.00
R7034:Ank3 UTSW 10 69,835,209 (GRCm39) missense probably damaging 1.00
R7036:Ank3 UTSW 10 69,835,209 (GRCm39) missense probably damaging 1.00
R7132:Ank3 UTSW 10 69,825,744 (GRCm39) missense
R7171:Ank3 UTSW 10 69,828,311 (GRCm39) missense
R7241:Ank3 UTSW 10 69,542,644 (GRCm39) start codon destroyed probably null 0.11
R7386:Ank3 UTSW 10 69,658,079 (GRCm39) missense unknown
R7445:Ank3 UTSW 10 69,827,954 (GRCm39) missense
R7452:Ank3 UTSW 10 69,734,881 (GRCm39) missense possibly damaging 0.53
R7492:Ank3 UTSW 10 69,718,357 (GRCm39) missense unknown
R7494:Ank3 UTSW 10 69,824,756 (GRCm39) missense
R7512:Ank3 UTSW 10 69,826,691 (GRCm39) missense
R7543:Ank3 UTSW 10 69,786,846 (GRCm39) missense possibly damaging 0.96
R7577:Ank3 UTSW 10 69,828,402 (GRCm39) missense
R7610:Ank3 UTSW 10 69,822,252 (GRCm39) missense
R7673:Ank3 UTSW 10 69,826,331 (GRCm39) missense
R7682:Ank3 UTSW 10 69,824,065 (GRCm39) missense possibly damaging 0.53
R7814:Ank3 UTSW 10 69,822,734 (GRCm39) missense
R7835:Ank3 UTSW 10 69,823,557 (GRCm39) missense
R7843:Ank3 UTSW 10 69,822,788 (GRCm39) missense probably benign 0.01
R7891:Ank3 UTSW 10 69,824,139 (GRCm39) missense probably damaging 1.00
R8109:Ank3 UTSW 10 69,826,148 (GRCm39) missense
R8175:Ank3 UTSW 10 69,729,339 (GRCm39) missense unknown
R8210:Ank3 UTSW 10 69,811,925 (GRCm39) missense possibly damaging 0.72
R8211:Ank3 UTSW 10 69,703,228 (GRCm39) missense unknown
R8299:Ank3 UTSW 10 69,811,981 (GRCm39) missense probably damaging 0.98
R8302:Ank3 UTSW 10 69,840,810 (GRCm39) missense possibly damaging 0.73
R8516:Ank3 UTSW 10 69,763,559 (GRCm39) nonsense probably null
R8543:Ank3 UTSW 10 69,838,266 (GRCm39) missense probably damaging 1.00
R8549:Ank3 UTSW 10 69,818,012 (GRCm39) missense possibly damaging 0.74
R8726:Ank3 UTSW 10 69,823,084 (GRCm39) missense
R8729:Ank3 UTSW 10 69,838,428 (GRCm39) missense possibly damaging 0.85
R8735:Ank3 UTSW 10 69,822,785 (GRCm39) missense probably benign 0.24
R8751:Ank3 UTSW 10 69,761,849 (GRCm39) intron probably benign
R8788:Ank3 UTSW 10 69,718,256 (GRCm39) missense unknown
R8875:Ank3 UTSW 10 69,660,233 (GRCm39) missense unknown
R8919:Ank3 UTSW 10 69,840,671 (GRCm39) missense possibly damaging 0.72
R8932:Ank3 UTSW 10 69,660,292 (GRCm39) missense probably benign 0.00
R9053:Ank3 UTSW 10 69,822,389 (GRCm39) missense
R9064:Ank3 UTSW 10 69,822,185 (GRCm39) missense
R9084:Ank3 UTSW 10 69,786,879 (GRCm39) missense probably benign 0.12
R9160:Ank3 UTSW 10 69,838,304 (GRCm39) missense unknown
R9275:Ank3 UTSW 10 69,822,662 (GRCm39) missense probably damaging 1.00
R9280:Ank3 UTSW 10 69,818,021 (GRCm39) missense possibly damaging 0.83
R9300:Ank3 UTSW 10 69,706,872 (GRCm39) missense unknown
R9302:Ank3 UTSW 10 69,761,849 (GRCm39) intron probably benign
R9327:Ank3 UTSW 10 69,812,086 (GRCm39) critical splice donor site probably null
R9336:Ank3 UTSW 10 69,809,578 (GRCm39) missense probably benign 0.00
R9345:Ank3 UTSW 10 69,761,899 (GRCm39) intron probably benign
R9368:Ank3 UTSW 10 69,823,329 (GRCm39) missense
R9406:Ank3 UTSW 10 69,645,011 (GRCm39) missense unknown
R9491:Ank3 UTSW 10 69,838,339 (GRCm39) critical splice acceptor site probably null
R9573:Ank3 UTSW 10 69,791,977 (GRCm39) nonsense probably null
R9674:Ank3 UTSW 10 69,824,549 (GRCm39) missense
R9710:Ank3 UTSW 10 69,829,070 (GRCm39) missense
R9720:Ank3 UTSW 10 69,825,335 (GRCm39) missense
R9767:Ank3 UTSW 10 69,823,799 (GRCm39) missense probably damaging 1.00
R9800:Ank3 UTSW 10 69,733,957 (GRCm39) missense unknown
Z1176:Ank3 UTSW 10 69,827,045 (GRCm39) missense
Z1176:Ank3 UTSW 10 69,786,840 (GRCm39) missense possibly damaging 0.85
Z1176:Ank3 UTSW 10 69,768,304 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGCCTTTATCTGCTGAGGC -3'
(R):5'- GGCACGTTAAATTTCATAATGGGC -3'

Sequencing Primer
(F):5'- TATCTGCTGAGGCGCAGTC -3'
(R):5'- GGCTTATGAAATTTCTCTGTAGGC -3'
Posted On 2014-11-12