Incidental Mutation 'R2421:Washc4'
ID249300
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission 040383-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2421 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83579521 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 792 (F792I)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably damaging
Transcript: ENSMUST00000038388
AA Change: F792I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: F792I

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218570
Meta Mutation Damage Score 0.7846 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adcy10 T A 1: 165,558,597 L1118Q probably damaging Het
Adgre4 A G 17: 55,778,872 E57G probably benign Het
Alpk2 T C 18: 65,306,616 S1036G probably benign Het
Ank3 T C 10: 69,982,204 probably benign Het
Ankfy1 T A 11: 72,755,896 probably benign Het
Antxrl A G 14: 34,071,689 probably benign Het
Apaf1 A T 10: 91,020,723 V874D probably damaging Het
Arhgap39 T A 15: 76,725,146 T1025S probably damaging Het
Arhgef12 A T 9: 43,001,006 C519S probably damaging Het
Aspm G A 1: 139,488,487 V1512M possibly damaging Het
Atp13a3 T C 16: 30,349,825 T449A probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Camk2d A G 3: 126,780,415 D157G probably damaging Het
Ccdc122 T C 14: 77,091,663 probably benign Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Col4a3 G A 1: 82,670,275 probably benign Het
Coq10b G A 1: 55,052,977 A35T probably benign Het
Creb3l3 T C 10: 81,091,818 I47V probably benign Het
Csgalnact1 A T 8: 68,461,508 I15N probably benign Het
Dcp1b A G 6: 119,215,266 Q381R probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Dnal1 C T 12: 84,136,706 Q80* probably null Het
Dtd2 A G 12: 51,999,855 V67A probably benign Het
Gart A G 16: 91,643,040 probably null Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm6327 T C 16: 12,760,094 noncoding transcript Het
Gm8674 T C 13: 49,900,663 noncoding transcript Het
Gpr107 G A 2: 31,185,529 G351S probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lenep G A 3: 89,402,574 probably null Het
Lrp1b T C 2: 40,882,133 probably benign Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Lyn C T 4: 3,748,787 A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 I2519K probably damaging Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Ms4a4b A G 19: 11,454,697 I61V possibly damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr175-ps1 T C 16: 58,824,346 D121G probably damaging Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr211 T A 6: 116,493,713 C35S probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pef1 C A 4: 130,127,317 C221* probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Pnliprp1 T A 19: 58,744,085 I460N probably benign Het
Ppfia4 T C 1: 134,327,400 N239S probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Prlr T A 15: 10,319,257 W91R probably damaging Het
Psmd2 T A 16: 20,660,106 probably null Het
Ptprt T A 2: 162,278,040 probably benign Het
Rbm12b2 T C 4: 12,095,127 F662S possibly damaging Het
Rgs6 C A 12: 83,116,283 T421K possibly damaging Het
Ryr2 T G 13: 11,591,237 Q4486H probably damaging Het
Scn7a A T 2: 66,726,302 probably benign Het
Smc1a A G X: 152,047,975 probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Syt9 G A 7: 107,436,781 R335K probably benign Het
Taar7a T C 10: 23,992,517 N322S probably damaging Het
Tfb2m C A 1: 179,533,666 W252C possibly damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw1 A T 5: 130,269,260 H214L probably damaging Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vangl2 T C 1: 172,007,959 Y382C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Vps13a T G 19: 16,759,671 I101L probably benign Het
Wdhd1 G A 14: 47,258,584 H608Y probably benign Het
Wdr48 T A 9: 119,902,404 I56K probably damaging Het
Xpo4 T C 14: 57,629,503 D194G probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp821 T A 8: 109,709,533 probably null Het
Zswim8 A G 14: 20,719,457 Y1237C probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7983:Washc4 UTSW 10 83573773 splice site probably null
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTCTCAAGGAGGTGATTCCGG -3'
(R):5'- AGACGTTCTCATTTACAGCTTTAGC -3'

Sequencing Primer
(F):5'- AGGTGATTCCGGCTGTGTAAG -3'
(R):5'- TTCTAGGGCAGTCAGGACTAC -3'
Posted On2014-11-12