Mutagenetix > Incidental Mutation

Incidental Mutation 'R2421:Apaf1'

249301

Institutional Source

Beutler Lab

Gene Symbol

Apaf1

Ensembl Gene

ENSMUSG00000019979

Gene Name

apoptotic peptidase activating factor 1

Synonyms

Apaf1l, 6230400I06Rik

MMRRC Submission

040383-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90989311-91082770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 91020723 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 874 (V874D)

Ref Sequence

ENSEMBL: ENSMUSP00000124134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]

AlphaFold

O88879

Predicted Effect

probably damaging
Transcript: ENSMUST00000020157
AA Change: V885D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: V885D

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.3e-22	PFAM
Pfam:NB-ARC	129	414	1.7e-77	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159110
AA Change: V885D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: V885D

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.4e-21	PFAM
Pfam:NB-ARC	129	414	6.9e-71	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000162618
AA Change: V874D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: V874D

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1.1e-20	PFAM
Pfam:NB-ARC	118	403	8.8e-72	PFAM
WD40	593	632	1.35e-5	SMART
WD40	635	674	1.04e-11	SMART
WD40	677	718	2.98e-7	SMART
WD40	721	760	9.88e-13	SMART
WD40	769	814	1.28e1	SMART
WD40	817	857	1.43e0	SMART
WD40	860	899	3.24e-8	SMART
WD40	941	978	2.57e0	SMART
WD40	981	1020	1.09e-5	SMART
WD40	1022	1060	2.09e-2	SMART
WD40	1063	1102	2.93e-6	SMART
WD40	1105	1144	8.55e-8	SMART
WD40	1157	1193	4.55e-3	SMART
Blast:WD40	1196	1235	5e-18	BLAST

Meta Mutation Damage Score

0.9731

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	C	5: 5,455,912	Y123C	probably benign	Het
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
Abraxas1	C	T	5: 100,812,174	R104H	possibly damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adcy10	T	A	1: 165,558,597	L1118Q	probably damaging	Het
Adgre4	A	G	17: 55,778,872	E57G	probably benign	Het
Alpk2	T	C	18: 65,306,616	S1036G	probably benign	Het
Ank3	T	C	10: 69,982,204		probably benign	Het
Ankfy1	T	A	11: 72,755,896		probably benign	Het
Antxrl	A	G	14: 34,071,689		probably benign	Het
Arhgap39	T	A	15: 76,725,146	T1025S	probably damaging	Het
Arhgef12	A	T	9: 43,001,006	C519S	probably damaging	Het
Aspm	G	A	1: 139,488,487	V1512M	possibly damaging	Het
Atp13a3	T	C	16: 30,349,825	T449A	probably benign	Het
Atxn2	A	T	5: 121,802,079		probably null	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Camk2d	A	G	3: 126,780,415	D157G	probably damaging	Het
Ccdc122	T	C	14: 77,091,663		probably benign	Het
Ccdc137	G	A	11: 120,462,264		probably null	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Col4a3	G	A	1: 82,670,275		probably benign	Het
Coq10b	G	A	1: 55,052,977	A35T	probably benign	Het
Creb3l3	T	C	10: 81,091,818	I47V	probably benign	Het
Csgalnact1	A	T	8: 68,461,508	I15N	probably benign	Het
Dcp1b	A	G	6: 119,215,266	Q381R	probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Dnal1	C	T	12: 84,136,706	Q80*	probably null	Het
Dtd2	A	G	12: 51,999,855	V67A	probably benign	Het
Gart	A	G	16: 91,643,040		probably null	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm6327	T	C	16: 12,760,094		noncoding transcript	Het
Gm8674	T	C	13: 49,900,663		noncoding transcript	Het
Gpr107	G	A	2: 31,185,529	G351S	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Krt13	A	T	11: 100,120,051	L159Q	probably benign	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lenep	G	A	3: 89,402,574		probably null	Het
Lrp1b	T	C	2: 40,882,133		probably benign	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Lyn	C	T	4: 3,748,787	A255V	possibly damaging	Het
Mdn1	T	A	4: 32,723,621	I2519K	probably damaging	Het
Mmaa	T	A	8: 79,281,432	R59W	probably damaging	Het
Ms4a4b	A	G	19: 11,454,697	I61V	possibly damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Olfr1219	T	C	2: 89,074,992	Y33C	possibly damaging	Het
Olfr175-ps1	T	C	16: 58,824,346	D121G	probably damaging	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr211	T	A	6: 116,493,713	C35S	probably benign	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pef1	C	A	4: 130,127,317	C221*	probably null	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Pnliprp1	T	A	19: 58,744,085	I460N	probably benign	Het
Ppfia4	T	C	1: 134,327,400	N239S	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Prlr	T	A	15: 10,319,257	W91R	probably damaging	Het
Psmd2	T	A	16: 20,660,106		probably null	Het
Ptprt	T	A	2: 162,278,040		probably benign	Het
Rbm12b2	T	C	4: 12,095,127	F662S	possibly damaging	Het
Rgs6	C	A	12: 83,116,283	T421K	possibly damaging	Het
Ryr2	T	G	13: 11,591,237	Q4486H	probably damaging	Het
Scn7a	A	T	2: 66,726,302		probably benign	Het
Smc1a	A	G	X: 152,047,975		probably benign	Het
Synrg	A	G	11: 84,009,224	E674G	probably damaging	Het
Syt9	G	A	7: 107,436,781	R335K	probably benign	Het
Taar7a	T	C	10: 23,992,517	N322S	probably damaging	Het
Tfb2m	C	A	1: 179,533,666	W252C	possibly damaging	Het
Tmub2	T	A	11: 102,287,755	D161E	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw1	A	T	5: 130,269,260	H214L	probably damaging	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vangl2	T	C	1: 172,007,959	Y382C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Vps13a	T	G	19: 16,759,671	I101L	probably benign	Het
Washc4	T	A	10: 83,579,521	F792I	probably damaging	Het
Wdhd1	G	A	14: 47,258,584	H608Y	probably benign	Het
Wdr48	T	A	9: 119,902,404	I56K	probably damaging	Het
Xpo4	T	C	14: 57,629,503	D194G	probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp821	T	A	8: 109,709,533		probably null	Het
Zswim8	A	G	14: 20,719,457	Y1237C	probably damaging	Het

Other mutations in Apaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Apaf1	APN	10	91023788	missense	probably damaging	0.99
IGL00819:Apaf1	APN	10	90997340	splice site	probably null
IGL01481:Apaf1	APN	10	91031588	missense	possibly damaging	0.84
IGL01713:Apaf1	APN	10	91061832	splice site	probably benign
IGL01715:Apaf1	APN	10	91058354	missense	probably benign	0.20
IGL02152:Apaf1	APN	10	91061819	missense	probably benign	0.24
IGL02331:Apaf1	APN	10	91059619	missense	probably damaging	1.00
IGL03071:Apaf1	APN	10	90997255	missense	possibly damaging	0.88
IGL03101:Apaf1	APN	10	91031559	missense	possibly damaging	0.89
IGL03244:Apaf1	APN	10	91049349	splice site	probably benign
Bedlam	UTSW	10	91060271	missense	probably damaging	0.99
Mayhem	UTSW	10	90999719	missense	probably damaging	0.99
Wipeout	UTSW	10	91056000	missense	probably damaging	1.00
R0520:Apaf1	UTSW	10	91079989	missense	probably damaging	0.99
R0600:Apaf1	UTSW	10	91060052	missense	probably damaging	1.00
R0607:Apaf1	UTSW	10	91009203	missense	probably damaging	1.00
R0688:Apaf1	UTSW	10	91061705	missense	possibly damaging	0.94
R0734:Apaf1	UTSW	10	91037021	missense	probably benign	0.02
R1256:Apaf1	UTSW	10	91058406	missense	probably benign
R1459:Apaf1	UTSW	10	91062160	missense	probably benign	0.00
R1485:Apaf1	UTSW	10	91060243	missense	probably benign	0.02
R1511:Apaf1	UTSW	10	91060185	missense	possibly damaging	0.81
R1531:Apaf1	UTSW	10	91054521	missense	probably damaging	1.00
R1705:Apaf1	UTSW	10	91067271	splice site	probably benign
R1919:Apaf1	UTSW	10	91077614	nonsense	probably null
R1925:Apaf1	UTSW	10	90999719	missense	probably damaging	0.99
R2001:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2002:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2006:Apaf1	UTSW	10	91061772	missense	probably damaging	1.00
R2043:Apaf1	UTSW	10	91037028	missense	probably damaging	1.00
R2073:Apaf1	UTSW	10	91031694	nonsense	probably null
R2101:Apaf1	UTSW	10	91060080	missense	probably benign	0.26
R2130:Apaf1	UTSW	10	91060165	nonsense	probably null
R2153:Apaf1	UTSW	10	91048090	missense	probably damaging	1.00
R2377:Apaf1	UTSW	10	91079893	missense	possibly damaging	0.95
R3835:Apaf1	UTSW	10	91059587	missense	probably benign	0.07
R4750:Apaf1	UTSW	10	91060188	missense	probably damaging	1.00
R5100:Apaf1	UTSW	10	90997287	missense	probably benign
R5135:Apaf1	UTSW	10	91060094	missense	probably damaging	1.00
R5497:Apaf1	UTSW	10	90999656	missense	probably damaging	1.00
R5511:Apaf1	UTSW	10	91054392	missense	probably damaging	1.00
R5659:Apaf1	UTSW	10	91062153	nonsense	probably null
R5730:Apaf1	UTSW	10	91020771	missense	possibly damaging	0.62
R6176:Apaf1	UTSW	10	91059571	critical splice donor site	probably null
R6242:Apaf1	UTSW	10	91062163	missense	probably damaging	1.00
R6292:Apaf1	UTSW	10	90991563	missense	possibly damaging	0.86
R6376:Apaf1	UTSW	10	91023811	missense	probably damaging	1.00
R6534:Apaf1	UTSW	10	91056000	missense	probably damaging	1.00
R6975:Apaf1	UTSW	10	91020734	missense	probably damaging	0.97
R7218:Apaf1	UTSW	10	91037002	missense	probably damaging	1.00
R7369:Apaf1	UTSW	10	91001036	missense	probably damaging	0.97
R7409:Apaf1	UTSW	10	91067246	missense	probably damaging	1.00
R7413:Apaf1	UTSW	10	90995680	missense	probably benign	0.28
R7418:Apaf1	UTSW	10	91023835	missense	probably benign	0.09
R7423:Apaf1	UTSW	10	91059606	missense	probably damaging	1.00
R7488:Apaf1	UTSW	10	91054380	missense	probably benign	0.35
R7765:Apaf1	UTSW	10	91023782	missense	probably benign	0.34
R7913:Apaf1	UTSW	10	91060271	missense	probably damaging	0.99
R7914:Apaf1	UTSW	10	91060233	missense	probably damaging	1.00
R7922:Apaf1	UTSW	10	90999753	missense	probably benign
R8131:Apaf1	UTSW	10	91077558	missense	possibly damaging	0.93
R8158:Apaf1	UTSW	10	91059658	missense	probably benign	0.05
R8673:Apaf1	UTSW	10	90995668	missense	probably damaging	1.00
R8682:Apaf1	UTSW	10	90995670	missense	probably damaging	1.00
R8962:Apaf1	UTSW	10	91067204	missense	probably damaging	1.00
R9069:Apaf1	UTSW	10	91023718	critical splice donor site	probably null
R9200:Apaf1	UTSW	10	91009240	missense	probably benign	0.24
R9516:Apaf1	UTSW	10	91079954	missense	probably damaging	1.00
R9623:Apaf1	UTSW	10	91077601	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTCACAGAATAGCACTTTTC -3'
(R):5'- ACCTGTACTAACATGGCAAGC -3'

Sequencing Primer
(F):5'- CACAGAATAGCACTTTTCCAGGATAG -3'
(R):5'- ACATGGCAAGCTTTGTTATTTCTG -3'

Posted On

2014-11-12