Incidental Mutation 'R2421:Ankfy1'
ID 249302
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Name ankyrin repeat and FYVE domain containing 1
Synonyms Ankhzn
MMRRC Submission 040383-MU
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 72690006-72772146 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 72755896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
AlphaFold Q810B6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102548
Predicted Effect probably benign
Transcript: ENSMUST00000127610
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147195
Predicted Effect probably benign
Transcript: ENSMUST00000155998
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adcy10 T A 1: 165,558,597 L1118Q probably damaging Het
Adgre4 A G 17: 55,778,872 E57G probably benign Het
Alpk2 T C 18: 65,306,616 S1036G probably benign Het
Ank3 T C 10: 69,982,204 probably benign Het
Antxrl A G 14: 34,071,689 probably benign Het
Apaf1 A T 10: 91,020,723 V874D probably damaging Het
Arhgap39 T A 15: 76,725,146 T1025S probably damaging Het
Arhgef12 A T 9: 43,001,006 C519S probably damaging Het
Aspm G A 1: 139,488,487 V1512M possibly damaging Het
Atp13a3 T C 16: 30,349,825 T449A probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Camk2d A G 3: 126,780,415 D157G probably damaging Het
Ccdc122 T C 14: 77,091,663 probably benign Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Col4a3 G A 1: 82,670,275 probably benign Het
Coq10b G A 1: 55,052,977 A35T probably benign Het
Creb3l3 T C 10: 81,091,818 I47V probably benign Het
Csgalnact1 A T 8: 68,461,508 I15N probably benign Het
Dcp1b A G 6: 119,215,266 Q381R probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Dnal1 C T 12: 84,136,706 Q80* probably null Het
Dtd2 A G 12: 51,999,855 V67A probably benign Het
Gart A G 16: 91,643,040 probably null Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm6327 T C 16: 12,760,094 noncoding transcript Het
Gm8674 T C 13: 49,900,663 noncoding transcript Het
Gpr107 G A 2: 31,185,529 G351S probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lenep G A 3: 89,402,574 probably null Het
Lrp1b T C 2: 40,882,133 probably benign Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Lyn C T 4: 3,748,787 A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 I2519K probably damaging Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Ms4a4b A G 19: 11,454,697 I61V possibly damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr175-ps1 T C 16: 58,824,346 D121G probably damaging Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr211 T A 6: 116,493,713 C35S probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pef1 C A 4: 130,127,317 C221* probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Pnliprp1 T A 19: 58,744,085 I460N probably benign Het
Ppfia4 T C 1: 134,327,400 N239S probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Prlr T A 15: 10,319,257 W91R probably damaging Het
Psmd2 T A 16: 20,660,106 probably null Het
Ptprt T A 2: 162,278,040 probably benign Het
Rbm12b2 T C 4: 12,095,127 F662S possibly damaging Het
Rgs6 C A 12: 83,116,283 T421K possibly damaging Het
Ryr2 T G 13: 11,591,237 Q4486H probably damaging Het
Scn7a A T 2: 66,726,302 probably benign Het
Smc1a A G X: 152,047,975 probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Syt9 G A 7: 107,436,781 R335K probably benign Het
Taar7a T C 10: 23,992,517 N322S probably damaging Het
Tfb2m C A 1: 179,533,666 W252C possibly damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw1 A T 5: 130,269,260 H214L probably damaging Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vangl2 T C 1: 172,007,959 Y382C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Vps13a T G 19: 16,759,671 I101L probably benign Het
Washc4 T A 10: 83,579,521 F792I probably damaging Het
Wdhd1 G A 14: 47,258,584 H608Y probably benign Het
Wdr48 T A 9: 119,902,404 I56K probably damaging Het
Xpo4 T C 14: 57,629,503 D194G probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp821 T A 8: 109,709,533 probably null Het
Zswim8 A G 14: 20,719,457 Y1237C probably damaging Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754 splice site probably benign
Betruenken UTSW 11 72753608 missense possibly damaging 0.78
Inebriated UTSW 11 72752105 missense probably benign
Smashed UTSW 11 72712204 missense probably damaging 1.00
woozy UTSW 11 72754459 missense probably benign 0.33
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1565:Ankfy1 UTSW 11 72757318 missense probably damaging 1.00
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5471:Ankfy1 UTSW 11 72728791 missense probably benign 0.01
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5770:Ankfy1 UTSW 11 72760256 missense probably damaging 1.00
R5896:Ankfy1 UTSW 11 72759985 missense probably damaging 0.98
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R7006:Ankfy1 UTSW 11 72740464 missense probably benign 0.01
R7329:Ankfy1 UTSW 11 72712208 missense probably damaging 0.96
R7393:Ankfy1 UTSW 11 72738308 missense possibly damaging 0.70
R7410:Ankfy1 UTSW 11 72761504 missense probably damaging 1.00
R7488:Ankfy1 UTSW 11 72759943 missense probably benign 0.05
R7731:Ankfy1 UTSW 11 72712281 missense probably benign 0.00
R7810:Ankfy1 UTSW 11 72754455 nonsense probably null
R8236:Ankfy1 UTSW 11 72754355 missense possibly damaging 0.90
R8709:Ankfy1 UTSW 11 72755706 missense possibly damaging 0.91
R8717:Ankfy1 UTSW 11 72730474 missense probably benign 0.01
R8839:Ankfy1 UTSW 11 72730566 missense probably benign 0.39
R8862:Ankfy1 UTSW 11 72753643 missense probably benign 0.18
R8954:Ankfy1 UTSW 11 72750491 missense possibly damaging 0.91
R9548:Ankfy1 UTSW 11 72750179 critical splice donor site probably null
R9762:Ankfy1 UTSW 11 72730575 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAACCAGCATAGCGTCATC -3'
(R):5'- TAATGCCAAGCCTCTTTGAGC -3'

Sequencing Primer
(F):5'- AGCATAGCGTCATCATTCAGCTG -3'
(R):5'- TCACCAAGTGGCTGTAATACAG -3'
Posted On 2014-11-12