Incidental Mutation 'R2421:Krt13'
ID 249304
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Name keratin 13
Synonyms Krt1-13, K13, Krt-1.13
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 100008153-100012392 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100010877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 159 (L159Q)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
AlphaFold P08730
Predicted Effect probably benign
Transcript: ENSMUST00000007275
AA Change: L159Q

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: L159Q

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Meta Mutation Damage Score 0.1425 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100,010,539 (GRCm39) missense probably damaging 1.00
IGL02532:Krt13 APN 11 100,010,195 (GRCm39) missense probably damaging 1.00
IGL02934:Krt13 APN 11 100,009,910 (GRCm39) missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100,010,862 (GRCm39) missense probably damaging 0.98
R0092:Krt13 UTSW 11 100,012,258 (GRCm39) nonsense probably null
R0722:Krt13 UTSW 11 100,009,979 (GRCm39) missense probably damaging 1.00
R1228:Krt13 UTSW 11 100,012,303 (GRCm39) missense probably benign 0.18
R1400:Krt13 UTSW 11 100,012,110 (GRCm39) missense probably damaging 1.00
R1751:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R4421:Krt13 UTSW 11 100,009,761 (GRCm39) missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100,008,827 (GRCm39) missense unknown
R4520:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
R4632:Krt13 UTSW 11 100,012,050 (GRCm39) missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100,010,189 (GRCm39) missense probably damaging 1.00
R4872:Krt13 UTSW 11 100,012,332 (GRCm39) start gained probably benign
R5709:Krt13 UTSW 11 100,008,469 (GRCm39) missense unknown
R6014:Krt13 UTSW 11 100,008,437 (GRCm39) missense unknown
R6323:Krt13 UTSW 11 100,011,976 (GRCm39) missense probably damaging 1.00
R6391:Krt13 UTSW 11 100,010,202 (GRCm39) missense probably damaging 0.96
R7535:Krt13 UTSW 11 100,008,824 (GRCm39) missense unknown
R7562:Krt13 UTSW 11 100,010,162 (GRCm39) missense probably damaging 1.00
R7867:Krt13 UTSW 11 100,012,008 (GRCm39) missense probably damaging 1.00
R7992:Krt13 UTSW 11 100,008,478 (GRCm39) missense unknown
R8379:Krt13 UTSW 11 100,009,706 (GRCm39) missense probably damaging 0.99
R8429:Krt13 UTSW 11 100,011,951 (GRCm39) missense probably damaging 1.00
R8560:Krt13 UTSW 11 100,009,676 (GRCm39) missense possibly damaging 0.85
R8728:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably null 0.73
R8879:Krt13 UTSW 11 100,010,211 (GRCm39) missense probably benign 0.00
R8973:Krt13 UTSW 11 100,010,264 (GRCm39) missense possibly damaging 0.83
R9610:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9611:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9746:Krt13 UTSW 11 100,011,987 (GRCm39) missense possibly damaging 0.90
X0013:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAACTCCAAGGCCCTTGC -3'
(R):5'- ACTACTGGAAGATGTTCTGAGTGG -3'

Sequencing Primer
(F):5'- AAGGCCCTTGCTCCTGGATG -3'
(R):5'- GGTGGGGCCTCTGAAATG -3'
Posted On 2014-11-12