Incidental Mutation 'R2421:Prlr'
ID 249318
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Name prolactin receptor
Synonyms Prlr-rs1, Pr-1
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 10177324-10349266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10319343 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 91 (W91R)
Ref Sequence ENSEMBL: ENSMUSP00000118355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000127467] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000130720] [ENSMUST00000134410] [ENSMUST00000137867] [ENSMUST00000148257]
AlphaFold Q08501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000005400
Predicted Effect probably damaging
Transcript: ENSMUST00000124470
AA Change: W91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: W91R

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127467
AA Change: W127R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116211
Gene: ENSMUSG00000005268
AA Change: W127R

DomainStartEndE-ValueType
FN3 59 143 3.78e0 SMART
Blast:FN3 158 185 7e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000128450
AA Change: W91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268
AA Change: W91R

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128921
AA Change: W91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268
AA Change: W91R

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130720
AA Change: W91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117084
Gene: ENSMUSG00000005268
AA Change: W91R

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132361
Predicted Effect probably damaging
Transcript: ENSMUST00000134410
AA Change: W91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120417
Gene: ENSMUSG00000005268
AA Change: W91R

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137867
AA Change: W91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268
AA Change: W91R

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145428
Predicted Effect probably damaging
Transcript: ENSMUST00000148257
AA Change: W91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268
AA Change: W91R

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Meta Mutation Damage Score 0.7913 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10,328,410 (GRCm39) missense probably benign 0.00
IGL00688:Prlr APN 15 10,322,467 (GRCm39) unclassified probably benign
IGL01527:Prlr APN 15 10,329,257 (GRCm39) missense probably benign 0.28
IGL01626:Prlr APN 15 10,328,804 (GRCm39) missense probably benign 0.12
IGL01660:Prlr APN 15 10,317,676 (GRCm39) missense probably damaging 1.00
IGL01835:Prlr APN 15 10,329,129 (GRCm39) missense probably damaging 1.00
IGL01926:Prlr APN 15 10,314,306 (GRCm39) start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10,328,428 (GRCm39) missense possibly damaging 0.95
IGL02306:Prlr APN 15 10,328,760 (GRCm39) missense probably benign 0.05
IGL02394:Prlr APN 15 10,328,664 (GRCm39) missense probably benign 0.03
IGL02430:Prlr APN 15 10,325,477 (GRCm39) missense probably damaging 1.00
IGL02695:Prlr APN 15 10,328,451 (GRCm39) missense probably benign 0.20
IGL02745:Prlr APN 15 10,328,680 (GRCm39) missense possibly damaging 0.50
IGL03193:Prlr APN 15 10,328,376 (GRCm39) missense possibly damaging 0.57
IGL03277:Prlr APN 15 10,328,887 (GRCm39) missense probably benign 0.01
IGL03379:Prlr APN 15 10,319,403 (GRCm39) missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10,328,458 (GRCm39) missense probably damaging 1.00
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0545:Prlr UTSW 15 10,317,652 (GRCm39) missense probably damaging 1.00
R1236:Prlr UTSW 15 10,325,367 (GRCm39) missense probably benign 0.13
R1352:Prlr UTSW 15 10,328,872 (GRCm39) missense probably benign
R1524:Prlr UTSW 15 10,319,419 (GRCm39) missense probably damaging 0.97
R1537:Prlr UTSW 15 10,328,364 (GRCm39) splice site probably null
R1690:Prlr UTSW 15 10,317,676 (GRCm39) missense probably damaging 1.00
R1773:Prlr UTSW 15 10,325,404 (GRCm39) nonsense probably null
R1789:Prlr UTSW 15 10,322,622 (GRCm39) missense probably benign 0.32
R4518:Prlr UTSW 15 10,329,085 (GRCm39) missense possibly damaging 0.53
R4621:Prlr UTSW 15 10,319,462 (GRCm39) intron probably benign
R4855:Prlr UTSW 15 10,328,883 (GRCm39) missense probably benign 0.01
R4957:Prlr UTSW 15 10,319,281 (GRCm39) missense probably damaging 1.00
R5053:Prlr UTSW 15 10,325,471 (GRCm39) missense probably benign 0.00
R5731:Prlr UTSW 15 10,314,221 (GRCm39) missense probably benign 0.00
R5749:Prlr UTSW 15 10,328,804 (GRCm39) missense probably benign 0.12
R5806:Prlr UTSW 15 10,319,290 (GRCm39) missense probably damaging 1.00
R5927:Prlr UTSW 15 10,322,532 (GRCm39) missense probably benign 0.42
R6170:Prlr UTSW 15 10,328,935 (GRCm39) missense probably benign 0.05
R6911:Prlr UTSW 15 10,329,270 (GRCm39) missense probably benign
R6935:Prlr UTSW 15 10,319,388 (GRCm39) missense probably damaging 1.00
R7327:Prlr UTSW 15 10,346,524 (GRCm39) missense probably benign 0.00
R7539:Prlr UTSW 15 10,329,109 (GRCm39) missense probably benign 0.11
R7579:Prlr UTSW 15 10,329,021 (GRCm39) missense probably benign 0.08
R7615:Prlr UTSW 15 10,326,010 (GRCm39) missense probably damaging 1.00
R7651:Prlr UTSW 15 10,328,464 (GRCm39) missense probably benign 0.26
R8213:Prlr UTSW 15 10,329,328 (GRCm39) missense possibly damaging 0.95
R8537:Prlr UTSW 15 10,314,266 (GRCm39) start gained probably benign
R9015:Prlr UTSW 15 10,319,352 (GRCm39) missense probably damaging 1.00
R9252:Prlr UTSW 15 10,326,550 (GRCm39) splice site probably benign
R9335:Prlr UTSW 15 10,325,357 (GRCm39) missense probably benign 0.08
R9341:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
R9343:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
Z1176:Prlr UTSW 15 10,314,341 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCCGCTGATATGAGTAGAG -3'
(R):5'- TTCTGGAATCCACCCATAAGCC -3'

Sequencing Primer
(F):5'- GAGCCACAGGAACCCATTTTTCTG -3'
(R):5'- CCAGGAAGACCCAGAGAGAGTTTG -3'
Posted On 2014-11-12