Incidental Mutation 'R2421:Dnajc21'
ID 249319
Institutional Source Beutler Lab
Gene Symbol Dnajc21
Ensembl Gene ENSMUSG00000044224
Gene Name DnaJ heat shock protein family (Hsp40) member C21
Synonyms 9930116P15Rik, 4930461P20Rik
MMRRC Submission 040383-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 10446756-10470516 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10461935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 127 (S127P)
Ref Sequence ENSEMBL: ENSMUSP00000116865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136591]
AlphaFold E9Q8D0
Predicted Effect probably benign
Transcript: ENSMUST00000136591
AA Change: S127P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116865
Gene: ENSMUSG00000044224
AA Change: S127P

DomainStartEndE-ValueType
DnaJ 2 61 7.2e-29 SMART
coiled coil region 178 283 N/A INTRINSIC
ZnF_U1 311 345 5.3e-8 SMART
ZnF_C2H2 314 338 1.67e-2 SMART
low complexity region 379 393 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
ZnF_C2H2 483 507 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145719
SMART Domains Protein: ENSMUSP00000116192
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
coiled coil region 26 131 N/A INTRINSIC
ZnF_U1 160 194 5.3e-8 SMART
ZnF_C2H2 163 187 1.67e-2 SMART
low complexity region 228 242 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
ZnF_C2H2 332 356 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147224
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the precursor 45S ribosomal RNA and may be involved in early nuclear ribosomal RNA biogenesis and maturation of the 60S ribosomal subunit. Mutations in this gene result in Bone marrow failure syndrome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adcy10 T A 1: 165,558,597 L1118Q probably damaging Het
Adgre4 A G 17: 55,778,872 E57G probably benign Het
Alpk2 T C 18: 65,306,616 S1036G probably benign Het
Ank3 T C 10: 69,982,204 probably benign Het
Ankfy1 T A 11: 72,755,896 probably benign Het
Antxrl A G 14: 34,071,689 probably benign Het
Apaf1 A T 10: 91,020,723 V874D probably damaging Het
Arhgap39 T A 15: 76,725,146 T1025S probably damaging Het
Arhgef12 A T 9: 43,001,006 C519S probably damaging Het
Aspm G A 1: 139,488,487 V1512M possibly damaging Het
Atp13a3 T C 16: 30,349,825 T449A probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Camk2d A G 3: 126,780,415 D157G probably damaging Het
Ccdc122 T C 14: 77,091,663 probably benign Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Col4a3 G A 1: 82,670,275 probably benign Het
Coq10b G A 1: 55,052,977 A35T probably benign Het
Creb3l3 T C 10: 81,091,818 I47V probably benign Het
Csgalnact1 A T 8: 68,461,508 I15N probably benign Het
Dcp1b A G 6: 119,215,266 Q381R probably benign Het
Dnal1 C T 12: 84,136,706 Q80* probably null Het
Dtd2 A G 12: 51,999,855 V67A probably benign Het
Gart A G 16: 91,643,040 probably null Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm6327 T C 16: 12,760,094 noncoding transcript Het
Gm8674 T C 13: 49,900,663 noncoding transcript Het
Gpr107 G A 2: 31,185,529 G351S probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lenep G A 3: 89,402,574 probably null Het
Lrp1b T C 2: 40,882,133 probably benign Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Lyn C T 4: 3,748,787 A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 I2519K probably damaging Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Ms4a4b A G 19: 11,454,697 I61V possibly damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr175-ps1 T C 16: 58,824,346 D121G probably damaging Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr211 T A 6: 116,493,713 C35S probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pef1 C A 4: 130,127,317 C221* probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Pnliprp1 T A 19: 58,744,085 I460N probably benign Het
Ppfia4 T C 1: 134,327,400 N239S probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Prlr T A 15: 10,319,257 W91R probably damaging Het
Psmd2 T A 16: 20,660,106 probably null Het
Ptprt T A 2: 162,278,040 probably benign Het
Rbm12b2 T C 4: 12,095,127 F662S possibly damaging Het
Rgs6 C A 12: 83,116,283 T421K possibly damaging Het
Ryr2 T G 13: 11,591,237 Q4486H probably damaging Het
Scn7a A T 2: 66,726,302 probably benign Het
Smc1a A G X: 152,047,975 probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Syt9 G A 7: 107,436,781 R335K probably benign Het
Taar7a T C 10: 23,992,517 N322S probably damaging Het
Tfb2m C A 1: 179,533,666 W252C possibly damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw1 A T 5: 130,269,260 H214L probably damaging Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vangl2 T C 1: 172,007,959 Y382C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Vps13a T G 19: 16,759,671 I101L probably benign Het
Washc4 T A 10: 83,579,521 F792I probably damaging Het
Wdhd1 G A 14: 47,258,584 H608Y probably benign Het
Wdr48 T A 9: 119,902,404 I56K probably damaging Het
Xpo4 T C 14: 57,629,503 D194G probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp821 T A 8: 109,709,533 probably null Het
Zswim8 A G 14: 20,719,457 Y1237C probably damaging Het
Other mutations in Dnajc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Dnajc21 APN 15 10447102 missense probably benign 0.01
IGL02797:Dnajc21 APN 15 10461355 missense probably damaging 0.96
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R1480:Dnajc21 UTSW 15 10459951 splice site probably null
R1694:Dnajc21 UTSW 15 10451563 missense probably benign 0.00
R1777:Dnajc21 UTSW 15 10449607 missense probably benign 0.00
R2420:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2422:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R4065:Dnajc21 UTSW 15 10451553 critical splice donor site probably null
R4182:Dnajc21 UTSW 15 10459933 splice site probably null
R4546:Dnajc21 UTSW 15 10447097 missense probably benign 0.01
R4644:Dnajc21 UTSW 15 10463917 missense possibly damaging 0.89
R4939:Dnajc21 UTSW 15 10449597 missense probably damaging 0.96
R5075:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R5187:Dnajc21 UTSW 15 10463964 missense probably benign 0.21
R5273:Dnajc21 UTSW 15 10454807 missense probably damaging 1.00
R5590:Dnajc21 UTSW 15 10462277 missense possibly damaging 0.92
R5643:Dnajc21 UTSW 15 10461915 missense probably benign
R5644:Dnajc21 UTSW 15 10461915 missense probably benign
R5729:Dnajc21 UTSW 15 10449596 missense probably benign 0.01
R6614:Dnajc21 UTSW 15 10470263 critical splice donor site probably null
R6815:Dnajc21 UTSW 15 10447691 splice site probably null
R7016:Dnajc21 UTSW 15 10461407 nonsense probably null
R7076:Dnajc21 UTSW 15 10449631 missense probably benign
R7584:Dnajc21 UTSW 15 10462295 nonsense probably null
R7624:Dnajc21 UTSW 15 10461232 missense probably benign 0.07
R7624:Dnajc21 UTSW 15 10461234 missense probably damaging 0.98
R7676:Dnajc21 UTSW 15 10462344 missense possibly damaging 0.95
R7788:Dnajc21 UTSW 15 10460047 missense probably damaging 1.00
R7845:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
R8552:Dnajc21 UTSW 15 10463919 nonsense probably null
R9174:Dnajc21 UTSW 15 10461990 nonsense probably null
R9416:Dnajc21 UTSW 15 10461962 missense possibly damaging 0.82
R9566:Dnajc21 UTSW 15 10463933 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCAAGAGTCAGTACAAGCTCCG -3'
(R):5'- GTGAATGCACGTCTGTTTAAGC -3'

Sequencing Primer
(F):5'- GTACAAGCTCCGGCAAAAATG -3'
(R):5'- AATGCACGTCTGTTTAAGCTGTGG -3'
Posted On 2014-11-12