Incidental Mutation 'R2421:Krt78'
ID 249323
Institutional Source Beutler Lab
Gene Symbol Krt78
Ensembl Gene ENSMUSG00000050463
Gene Name keratin 78
Synonyms 2310030B04Rik
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R2421 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101854436-101862722 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101855699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 704 (E704G)
Ref Sequence ENSEMBL: ENSMUSP00000126197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164932]
AlphaFold E9Q0F0
Predicted Effect probably damaging
Transcript: ENSMUST00000164932
AA Change: E704G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: E704G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 101 5.7e-16 PFAM
Filament 104 417 1.38e-133 SMART
internal_repeat_1 421 660 8.87e-74 PROSPERO
internal_repeat_1 704 957 8.87e-74 PROSPERO
low complexity region 1033 1049 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Krt78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt78 APN 15 101,855,945 (GRCm39) missense probably benign 0.28
IGL01358:Krt78 APN 15 101,854,698 (GRCm39) missense probably benign 0.18
IGL01723:Krt78 APN 15 101,860,233 (GRCm39) missense possibly damaging 0.65
IGL01743:Krt78 APN 15 101,859,333 (GRCm39) missense probably benign 0.06
IGL01778:Krt78 APN 15 101,859,402 (GRCm39) missense probably damaging 1.00
IGL01792:Krt78 APN 15 101,855,085 (GRCm39) missense probably benign 0.01
IGL02271:Krt78 APN 15 101,857,028 (GRCm39) missense probably benign 0.02
IGL02481:Krt78 APN 15 101,856,853 (GRCm39) splice site probably benign
IGL02494:Krt78 APN 15 101,862,486 (GRCm39) missense probably benign 0.00
IGL02708:Krt78 APN 15 101,861,842 (GRCm39) missense possibly damaging 0.88
IGL02747:Krt78 APN 15 101,858,819 (GRCm39) splice site probably benign
IGL02997:Krt78 APN 15 101,855,598 (GRCm39) missense probably benign 0.11
IGL03350:Krt78 APN 15 101,854,952 (GRCm39) missense probably benign 0.02
IGL03410:Krt78 APN 15 101,862,421 (GRCm39) missense probably damaging 0.99
PIT4812001:Krt78 UTSW 15 101,856,504 (GRCm39) missense probably damaging 1.00
R0090:Krt78 UTSW 15 101,856,272 (GRCm39) missense probably benign 0.35
R0513:Krt78 UTSW 15 101,859,384 (GRCm39) missense probably damaging 1.00
R0908:Krt78 UTSW 15 101,859,336 (GRCm39) missense probably damaging 1.00
R1067:Krt78 UTSW 15 101,854,896 (GRCm39) nonsense probably null
R1070:Krt78 UTSW 15 101,854,728 (GRCm39) missense possibly damaging 0.86
R1194:Krt78 UTSW 15 101,860,221 (GRCm39) missense probably damaging 0.99
R1213:Krt78 UTSW 15 101,860,245 (GRCm39) missense probably benign 0.10
R1467:Krt78 UTSW 15 101,854,728 (GRCm39) missense possibly damaging 0.86
R1467:Krt78 UTSW 15 101,854,728 (GRCm39) missense possibly damaging 0.86
R1612:Krt78 UTSW 15 101,860,279 (GRCm39) splice site probably null
R1750:Krt78 UTSW 15 101,854,812 (GRCm39) missense probably benign 0.33
R1796:Krt78 UTSW 15 101,859,300 (GRCm39) missense probably damaging 1.00
R1863:Krt78 UTSW 15 101,855,004 (GRCm39) missense possibly damaging 0.53
R1901:Krt78 UTSW 15 101,855,398 (GRCm39) nonsense probably null
R1902:Krt78 UTSW 15 101,855,398 (GRCm39) nonsense probably null
R1975:Krt78 UTSW 15 101,854,603 (GRCm39) makesense probably null
R2105:Krt78 UTSW 15 101,855,849 (GRCm39) missense possibly damaging 0.93
R2418:Krt78 UTSW 15 101,855,069 (GRCm39) missense probably benign
R2422:Krt78 UTSW 15 101,855,699 (GRCm39) missense probably damaging 0.96
R2443:Krt78 UTSW 15 101,855,033 (GRCm39) missense probably damaging 1.00
R2897:Krt78 UTSW 15 101,855,541 (GRCm39) missense probably benign
R4422:Krt78 UTSW 15 101,856,375 (GRCm39) missense probably benign 0.13
R4424:Krt78 UTSW 15 101,856,375 (GRCm39) missense probably benign 0.13
R4425:Krt78 UTSW 15 101,856,375 (GRCm39) missense probably benign 0.13
R4583:Krt78 UTSW 15 101,855,055 (GRCm39) missense possibly damaging 0.53
R4752:Krt78 UTSW 15 101,856,637 (GRCm39) missense probably benign 0.05
R4927:Krt78 UTSW 15 101,855,334 (GRCm39) missense probably benign 0.02
R5129:Krt78 UTSW 15 101,856,015 (GRCm39) missense possibly damaging 0.70
R5391:Krt78 UTSW 15 101,860,263 (GRCm39) nonsense probably null
R5575:Krt78 UTSW 15 101,855,787 (GRCm39) nonsense probably null
R5617:Krt78 UTSW 15 101,856,044 (GRCm39) missense probably damaging 0.99
R5806:Krt78 UTSW 15 101,858,937 (GRCm39) missense probably damaging 1.00
R5906:Krt78 UTSW 15 101,857,030 (GRCm39) missense probably damaging 0.98
R5993:Krt78 UTSW 15 101,858,884 (GRCm39) missense probably damaging 1.00
R6520:Krt78 UTSW 15 101,860,206 (GRCm39) missense probably benign 0.26
R6531:Krt78 UTSW 15 101,860,708 (GRCm39) missense probably benign 0.03
R6587:Krt78 UTSW 15 101,860,704 (GRCm39) missense probably benign 0.10
R6749:Krt78 UTSW 15 101,859,358 (GRCm39) missense probably damaging 1.00
R7126:Krt78 UTSW 15 101,856,871 (GRCm39) missense probably damaging 1.00
R7158:Krt78 UTSW 15 101,860,241 (GRCm39) missense probably benign 0.17
R7229:Krt78 UTSW 15 101,855,829 (GRCm39) missense probably benign 0.01
R7523:Krt78 UTSW 15 101,855,036 (GRCm39) missense not run
R7638:Krt78 UTSW 15 101,859,318 (GRCm39) missense probably damaging 1.00
R7879:Krt78 UTSW 15 101,856,624 (GRCm39) missense probably benign 0.22
R8013:Krt78 UTSW 15 101,856,977 (GRCm39) missense probably damaging 0.99
R8085:Krt78 UTSW 15 101,855,715 (GRCm39) missense possibly damaging 0.91
R8209:Krt78 UTSW 15 101,855,480 (GRCm39) missense possibly damaging 0.56
R8226:Krt78 UTSW 15 101,855,480 (GRCm39) missense possibly damaging 0.56
R8309:Krt78 UTSW 15 101,854,922 (GRCm39) missense probably benign 0.00
R8728:Krt78 UTSW 15 101,856,225 (GRCm39) missense probably benign 0.11
R8729:Krt78 UTSW 15 101,855,455 (GRCm39) missense probably damaging 0.98
R8887:Krt78 UTSW 15 101,861,746 (GRCm39) missense probably damaging 1.00
R9008:Krt78 UTSW 15 101,855,211 (GRCm39) small deletion probably benign
X0018:Krt78 UTSW 15 101,860,235 (GRCm39) missense possibly damaging 0.96
Z1088:Krt78 UTSW 15 101,855,766 (GRCm39) missense possibly damaging 0.91
Z1177:Krt78 UTSW 15 101,856,095 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATATTCTCTTCCAGGCACGG -3'
(R):5'- CATGCCTGGAAGAGGATCTG -3'

Sequencing Primer
(F):5'- TCTTCCAGGCACGGTCACC -3'
(R):5'- TGGAGGCCAGGTGACCATG -3'
Posted On 2014-11-12