Incidental Mutation 'R2421:Gart'
ID 249329
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Name phosphoribosylglycinamide formyltransferase
Synonyms Prgs, Gaps
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 91418074-91443840 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 91439928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000120450] [ENSMUST00000122302] [ENSMUST00000140312] [ENSMUST00000156713] [ENSMUST00000231444] [ENSMUST00000232289] [ENSMUST00000231380] [ENSMUST00000232367]
AlphaFold Q64737
Predicted Effect probably damaging
Transcript: ENSMUST00000023684
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: L21P

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114036
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114037
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117633
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119368
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120450
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962
AA Change: L21P

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140312
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156713
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962
AA Change: L21P

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231444
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232289
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231380
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232367
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231863
Meta Mutation Damage Score 0.9719 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91,435,677 (GRCm39) missense possibly damaging 0.58
IGL00837:Gart APN 16 91,435,608 (GRCm39) unclassified probably benign
IGL01010:Gart APN 16 91,439,980 (GRCm39) nonsense probably null
IGL01064:Gart APN 16 91,419,895 (GRCm39) missense probably damaging 1.00
IGL01451:Gart APN 16 91,422,400 (GRCm39) missense probably benign
IGL02084:Gart APN 16 91,418,488 (GRCm39) missense probably benign
IGL02301:Gart APN 16 91,418,725 (GRCm39) splice site probably benign
IGL02814:Gart APN 16 91,420,345 (GRCm39) missense possibly damaging 0.58
sylvester UTSW 16 91,427,490 (GRCm39) splice site probably benign
PIT4453001:Gart UTSW 16 91,433,426 (GRCm39) missense probably damaging 1.00
R0137:Gart UTSW 16 91,422,282 (GRCm39) missense probably benign
R0197:Gart UTSW 16 91,420,291 (GRCm39) missense possibly damaging 0.95
R0321:Gart UTSW 16 91,419,925 (GRCm39) unclassified probably benign
R0322:Gart UTSW 16 91,419,925 (GRCm39) unclassified probably benign
R0398:Gart UTSW 16 91,436,337 (GRCm39) missense probably damaging 1.00
R0410:Gart UTSW 16 91,438,215 (GRCm39) missense probably damaging 1.00
R0496:Gart UTSW 16 91,419,925 (GRCm39) unclassified probably benign
R0620:Gart UTSW 16 91,427,490 (GRCm39) splice site probably benign
R0628:Gart UTSW 16 91,430,790 (GRCm39) missense probably benign 0.01
R0883:Gart UTSW 16 91,420,291 (GRCm39) missense possibly damaging 0.95
R1346:Gart UTSW 16 91,425,070 (GRCm39) splice site probably null
R1490:Gart UTSW 16 91,421,232 (GRCm39) missense probably damaging 1.00
R1686:Gart UTSW 16 91,422,237 (GRCm39) missense probably damaging 1.00
R1751:Gart UTSW 16 91,439,837 (GRCm39) splice site probably benign
R1917:Gart UTSW 16 91,425,037 (GRCm39) missense probably damaging 1.00
R2144:Gart UTSW 16 91,426,969 (GRCm39) missense probably damaging 1.00
R4305:Gart UTSW 16 91,430,880 (GRCm39) missense possibly damaging 0.48
R4377:Gart UTSW 16 91,430,982 (GRCm39) missense probably benign 0.31
R4599:Gart UTSW 16 91,419,833 (GRCm39) nonsense probably null
R4619:Gart UTSW 16 91,422,321 (GRCm39) missense probably damaging 1.00
R4620:Gart UTSW 16 91,422,321 (GRCm39) missense probably damaging 1.00
R5112:Gart UTSW 16 91,430,933 (GRCm39) missense probably benign 0.02
R5902:Gart UTSW 16 91,425,415 (GRCm39) missense probably damaging 1.00
R5975:Gart UTSW 16 91,421,224 (GRCm39) missense probably damaging 1.00
R6736:Gart UTSW 16 91,432,995 (GRCm39) missense probably benign 0.21
R7041:Gart UTSW 16 91,440,031 (GRCm39) start gained probably benign
R7150:Gart UTSW 16 91,425,351 (GRCm39) missense possibly damaging 0.69
R7320:Gart UTSW 16 91,418,569 (GRCm39) missense probably benign 0.00
R7709:Gart UTSW 16 91,419,853 (GRCm39) missense possibly damaging 0.92
R7748:Gart UTSW 16 91,427,540 (GRCm39) missense possibly damaging 0.66
R7911:Gart UTSW 16 91,435,672 (GRCm39) missense probably benign 0.23
R8066:Gart UTSW 16 91,436,335 (GRCm39) missense probably benign
R8209:Gart UTSW 16 91,425,041 (GRCm39) missense possibly damaging 0.78
R8824:Gart UTSW 16 91,427,591 (GRCm39) missense possibly damaging 0.64
R8840:Gart UTSW 16 91,433,010 (GRCm39) missense probably benign 0.02
R9046:Gart UTSW 16 91,418,561 (GRCm39) missense probably damaging 1.00
R9178:Gart UTSW 16 91,430,904 (GRCm39) missense possibly damaging 0.87
R9514:Gart UTSW 16 91,427,596 (GRCm39) missense probably benign 0.03
R9753:Gart UTSW 16 91,430,949 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGAATTCACGTTAATACCTCAA -3'
(R):5'- TCTCTGGATGAAAATGTCACATGTAT -3'

Sequencing Primer
(F):5'- CGCTCCCCATTTTGAAAC -3'
(R):5'- TTGAGTCTAGCCTGAGCAAC -3'
Posted On 2014-11-12