Incidental Mutation 'R2421:Gart'
ID249329
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 040383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2421 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 91643040 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000120450] [ENSMUST00000122302] [ENSMUST00000140312] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000231444] [ENSMUST00000232289] [ENSMUST00000232367]
Predicted Effect probably damaging
Transcript: ENSMUST00000023684
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: L21P

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114036
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114037
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117633
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119368
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120450
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962
AA Change: L21P

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140312
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156713
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962
AA Change: L21P

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231380
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231444
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231702
Predicted Effect probably damaging
Transcript: ENSMUST00000232289
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232367
AA Change: L21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231863
Meta Mutation Damage Score 0.9719 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adcy10 T A 1: 165,558,597 L1118Q probably damaging Het
Adgre4 A G 17: 55,778,872 E57G probably benign Het
Alpk2 T C 18: 65,306,616 S1036G probably benign Het
Ank3 T C 10: 69,982,204 probably benign Het
Ankfy1 T A 11: 72,755,896 probably benign Het
Antxrl A G 14: 34,071,689 probably benign Het
Apaf1 A T 10: 91,020,723 V874D probably damaging Het
Arhgap39 T A 15: 76,725,146 T1025S probably damaging Het
Arhgef12 A T 9: 43,001,006 C519S probably damaging Het
Aspm G A 1: 139,488,487 V1512M possibly damaging Het
Atp13a3 T C 16: 30,349,825 T449A probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Camk2d A G 3: 126,780,415 D157G probably damaging Het
Ccdc122 T C 14: 77,091,663 probably benign Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Col4a3 G A 1: 82,670,275 probably benign Het
Coq10b G A 1: 55,052,977 A35T probably benign Het
Creb3l3 T C 10: 81,091,818 I47V probably benign Het
Csgalnact1 A T 8: 68,461,508 I15N probably benign Het
Dcp1b A G 6: 119,215,266 Q381R probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Dnal1 C T 12: 84,136,706 Q80* probably null Het
Dtd2 A G 12: 51,999,855 V67A probably benign Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm6327 T C 16: 12,760,094 noncoding transcript Het
Gm8674 T C 13: 49,900,663 noncoding transcript Het
Gpr107 G A 2: 31,185,529 G351S probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lenep G A 3: 89,402,574 probably null Het
Lrp1b T C 2: 40,882,133 probably benign Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Lyn C T 4: 3,748,787 A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 I2519K probably damaging Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Ms4a4b A G 19: 11,454,697 I61V possibly damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr175-ps1 T C 16: 58,824,346 D121G probably damaging Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr211 T A 6: 116,493,713 C35S probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pef1 C A 4: 130,127,317 C221* probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Pnliprp1 T A 19: 58,744,085 I460N probably benign Het
Ppfia4 T C 1: 134,327,400 N239S probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Prlr T A 15: 10,319,257 W91R probably damaging Het
Psmd2 T A 16: 20,660,106 probably null Het
Ptprt T A 2: 162,278,040 probably benign Het
Rbm12b2 T C 4: 12,095,127 F662S possibly damaging Het
Rgs6 C A 12: 83,116,283 T421K possibly damaging Het
Ryr2 T G 13: 11,591,237 Q4486H probably damaging Het
Scn7a A T 2: 66,726,302 probably benign Het
Smc1a A G X: 152,047,975 probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Syt9 G A 7: 107,436,781 R335K probably benign Het
Taar7a T C 10: 23,992,517 N322S probably damaging Het
Tfb2m C A 1: 179,533,666 W252C possibly damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw1 A T 5: 130,269,260 H214L probably damaging Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vangl2 T C 1: 172,007,959 Y382C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Vps13a T G 19: 16,759,671 I101L probably benign Het
Washc4 T A 10: 83,579,521 F792I probably damaging Het
Wdhd1 G A 14: 47,258,584 H608Y probably benign Het
Wdr48 T A 9: 119,902,404 I56K probably damaging Het
Xpo4 T C 14: 57,629,503 D194G probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp821 T A 8: 109,709,533 probably null Het
Zswim8 A G 14: 20,719,457 Y1237C probably damaging Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
R8209:Gart UTSW 16 91628153 missense possibly damaging 0.78
R8824:Gart UTSW 16 91630703 missense possibly damaging 0.64
R8840:Gart UTSW 16 91636122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGAGAATTCACGTTAATACCTCAA -3'
(R):5'- TCTCTGGATGAAAATGTCACATGTAT -3'

Sequencing Primer
(F):5'- CGCTCCCCATTTTGAAAC -3'
(R):5'- TTGAGTCTAGCCTGAGCAAC -3'
Posted On2014-11-12